ID: 1193095247

View in Genome Browser
Species Human (GRCh38)
Location X:77541245-77541267
Sequence GCACCCTCCCAAGTCTAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 4, 2: 48, 3: 67, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193095247 Original CRISPR GCACCCTCCCAAGTCTAAAC CGG Intronic
902096438 1:13949877-13949899 GAATCCTCCCAGGTCCAAACTGG - Intergenic
903354619 1:22738952-22738974 GCTCACTCCCAAGTCTCACCTGG + Intronic
903524898 1:23986253-23986275 TCAGCCTCCCAAGTATTAACAGG + Intergenic
903675033 1:25058340-25058362 ACACTCTCCCAAGACTAAACCGG + Intergenic
904755240 1:32765352-32765374 GCACCCTGCCAAGTCTAGTCTGG + Intronic
905362793 1:37431875-37431897 CCACCCTCCCACATCTAAGCTGG + Intergenic
908451036 1:64255197-64255219 ACACCTTCCCAAGACTGAACCGG + Intronic
908665388 1:66484213-66484235 ACACTCTCCCAAGACTAAACCGG + Intergenic
909691569 1:78413089-78413111 ACACCCTCCCAAGACTGAACTGG + Intronic
910600909 1:89031248-89031270 ACACCCTCCCAAGACTAAACAGG - Intergenic
911294266 1:96094851-96094873 GCACCCTAGCAAGTGAAAACGGG - Intergenic
911899478 1:103484739-103484761 ACACCCTCCCAAGACTAAAATGG + Intergenic
913535959 1:119772614-119772636 CCACCTTCCCAAGTCAAAAATGG - Intergenic
914391837 1:147230723-147230745 ACACCCTCCCAAGACTAAACCGG - Intronic
914401818 1:147328026-147328048 ACACCCTCCCAAGAATAAGCAGG + Intergenic
915428236 1:155844788-155844810 AAACCCTCCCAAGTCTCACCTGG + Intronic
915556128 1:156661763-156661785 CCTCCTTCCCACGTCTAAACAGG + Intergenic
915852920 1:159347183-159347205 ACACCCTCCCAAGACTAACTAGG + Intergenic
916988628 1:170218347-170218369 GCCACCTCCCAAGTCCTAACCGG - Intergenic
918424142 1:184391358-184391380 GCAGCTTCCCCAGTCTAAAATGG + Intronic
919269012 1:195314254-195314276 ACACCCTCACAAGACTGAACCGG + Intergenic
920349745 1:205329907-205329929 GCTCCCTTCCAAGGCTAAGCAGG + Intergenic
923547277 1:234932022-234932044 GCCCCCTCCCCAGTCTACACCGG + Intergenic
1063282803 10:4649043-4649065 TCACCCTACCAAGTCTTAAATGG - Intergenic
1063626978 10:7699409-7699431 GCTCCCTCCAAGGTGTAAACAGG - Intergenic
1065119062 10:22510837-22510859 ACACCCTCCCAAAACTAAACCGG - Intergenic
1067127332 10:43530182-43530204 ACACTCTCCCAAGACTAAACCGG - Intergenic
1068280405 10:54861395-54861417 ACAACCTCCCAAGTTTGAACCGG + Intronic
1068641308 10:59411043-59411065 ACACCCTCCCAAGACTAAACTGG - Intergenic
1071001712 10:80838465-80838487 ACACCCTCCCAAGAGTAACCAGG - Intergenic
1072192914 10:93090692-93090714 CCAGCCTCCCAACTCTAATCAGG + Intergenic
1072361110 10:94660278-94660300 ACACCCTCCCAAGATTAAGCTGG - Intergenic
1074621908 10:115134463-115134485 ACACCCTCCCAAGACTAACCAGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1077710824 11:4535174-4535196 ACTCCCTCCCAAGACTAAACAGG + Intergenic
1078812382 11:14781091-14781113 ACACCCTCCCAAGACTAAACAGG + Intronic
1079271572 11:18991423-18991445 ACACCCTCCCAAGACTAAACTGG - Intergenic
1079362293 11:19779076-19779098 GCTCCCTCCATAGACTAAACGGG - Intronic
1079769763 11:24444625-24444647 GCATCCTCCCAACTCTAGAATGG + Intergenic
1080164585 11:29221660-29221682 ACAGCCTCCCAAGACTGAACTGG - Intergenic
1080253737 11:30265856-30265878 ACATCCTCCCAAGACTAAACCGG - Intergenic
1082582767 11:54893969-54893991 ACTCCCTCCCAAGACTAAACTGG - Intergenic
1082956339 11:58874000-58874022 ACACTCTCCCAAGACTAAACCGG - Intronic
1086610655 11:88751382-88751404 ACACCCTCTCAAGACTGAACCGG + Intronic
1086967628 11:93046315-93046337 ACACCCTCCCAAGAGTAACCAGG + Intergenic
1087213796 11:95472297-95472319 ACATCCTCCCAAGACTAAACAGG - Intergenic
1087341321 11:96911344-96911366 ACACCCTCCCAAGACTAAACCGG + Intergenic
1087817095 11:102671256-102671278 GCAACCTGCCAAGACTGAACCGG - Intergenic
1087920004 11:103855857-103855879 ACGCCCTCCCAAGACTGAACCGG + Intergenic
1091317728 11:134626244-134626266 GCACCCTCCCCAGACCAAAAGGG - Intergenic
1093265764 12:17001734-17001756 ACACCCTCCTAAGACTAAAACGG + Intergenic
1095348528 12:41181653-41181675 ACACCCTCCAAAGACTAACCAGG - Intergenic
1095695172 12:45135890-45135912 ACACCCTCCGAAGACTAACCAGG + Intergenic
1095830674 12:46583009-46583031 ACACCCTCCCAAGACTAAACCGG - Intergenic
1097701313 12:62823171-62823193 ACACCCTCCCAAGACTAAATTGG + Intronic
1097910397 12:64963442-64963464 ACACTCTCCCAAGACTGAACTGG - Intergenic
1099897832 12:88670882-88670904 ACACCCTCCCGAGACTAAACGGG + Intergenic
1100328010 12:93559306-93559328 ACACCCTCCCAAGACTAACCAGG + Intergenic
1106025971 13:25955553-25955575 ACACCCTCCCAAGACTAAACTGG + Intronic
1106617550 13:31343840-31343862 ACACCCTCCCAAGACTAAACCGG + Intergenic
1107776945 13:43854403-43854425 ACACCCTCCCAAGACTGAACCGG + Intronic
1108925172 13:55733721-55733743 ACACTCTCCCAAGACTAAACCGG + Intergenic
1115184235 14:30666829-30666851 ATACCCTCCCAAGACTAAACTGG + Intronic
1116036725 14:39636244-39636266 ACACCCTCCCAAGACTAAACTGG - Intergenic
1116704747 14:48282422-48282444 GCACCATCTCAAGACTAAAGCGG - Intergenic
1118426231 14:65666459-65666481 ACAACCTCCCAAGACTGAACCGG + Intronic
1119313571 14:73672109-73672131 GTAACCTCCCAAGACAAAACAGG + Intronic
1125288819 15:38123151-38123173 ACACCCACCCAAAACTAAACTGG + Intergenic
1127182453 15:56436880-56436902 ACACCCTCCCAAGACTAAGCTGG + Intronic
1128696884 15:69772483-69772505 ACACCCTCCCAAGACTAAACCGG + Intergenic
1129578793 15:76783310-76783332 ACACCCTCCCAAGACTAAACTGG + Intronic
1129689561 15:77705569-77705591 GCACCCTCCCAAGACCAAGAAGG + Intronic
1131589879 15:93737173-93737195 ACACCATCCCAAGACTTAACCGG - Intergenic
1136645677 16:31612332-31612354 ACACCCTCCCAAGACTAAATCGG + Intergenic
1136677830 16:31929411-31929433 ACAACCTCCCAAGACTGAACTGG + Intergenic
1137046411 16:35667159-35667181 ACACCATCCCAAGAATAAACCGG + Intergenic
1138843345 16:60536010-60536032 ACACACTCCCAAGACTAATCAGG - Intergenic
1144448867 17:15358075-15358097 ACAACCTCCCACGACTAAACCGG + Intergenic
1149487017 17:57050449-57050471 GCCCCCTCCAAAGACTCAACTGG + Intergenic
1150996779 17:70327709-70327731 CAACACTCCCAAGTCTAATCGGG + Intergenic
1151803070 17:76389036-76389058 GGATCCATCCAAGTCTAAACTGG + Intergenic
1152157175 17:78642079-78642101 CCACCCTGCCAAGTGTAAAGTGG - Intergenic
1156143660 18:34147929-34147951 ACACCCTCCCAAAACTAAACCGG - Intronic
1157067000 18:44363711-44363733 ACACCCTCCAAATACTAAACCGG - Intergenic
1158945441 18:62443459-62443481 GTCCCCTCCCGAGTCTACACAGG + Intergenic
1161994648 19:7704648-7704670 ACACCCTCCCCACTCTCAACTGG - Intergenic
1163129426 19:15263401-15263423 GCGCCCTCCCAAGCCTCACCTGG + Exonic
1163649385 19:18508497-18508519 GGACCCTCCAAAGTCTCAACTGG + Intronic
1163973717 19:20827937-20827959 ACACCCTCCCAAGACTAAACCGG + Intronic
1164152075 19:22563069-22563091 ACACCCTCCCAAGATTAACCAGG - Intergenic
1164405157 19:27937766-27937788 CCACCCTGCCCAGTGTAAACTGG - Intergenic
1165262140 19:34628544-34628566 ACACCCTCCCAAGACTAAACCGG + Intronic
1165563317 19:36700636-36700658 ACACTCTCCCAAGACTAACCAGG - Intronic
1165797677 19:38528311-38528333 GCACCCTTACAAGTCTAAGAAGG + Exonic
1166063650 19:40343439-40343461 GCACCCTCCCAATTCACAAATGG - Intronic
930195076 2:48501357-48501379 GCACCCTCCCTGGTCTAGTCTGG - Intronic
933465438 2:82645132-82645154 CCACCCTCCCAAGGTTTAACTGG + Intergenic
933990011 2:87627331-87627353 GCACACACCCAAGAATAAACTGG + Intergenic
935382744 2:102468971-102468993 TCACCATCACAAGTATAAACAGG + Intergenic
936798271 2:116234158-116234180 ACACCCTCCCAAGTCTAAACCGG + Intergenic
936871254 2:117136076-117136098 AGACCCTCCCAATCCTAAACAGG - Intergenic
936898951 2:117461819-117461841 ACACTCTCCCAAGACTAAACCGG - Intergenic
937762670 2:125624795-125624817 AAACCCTCTCAAGACTAAACCGG + Intergenic
937978357 2:127595182-127595204 ACACCCTCCCAAGATTAACCAGG - Intronic
940474957 2:154150643-154150665 ACACTCTCCCAAGACTAAACCGG - Intronic
941426608 2:165353831-165353853 GCCCCCTCCCAAGTCTCATGTGG - Intronic
941593142 2:167444580-167444602 GCACCCTCCCAAGACTAAAAAGG - Intergenic
942732994 2:179079919-179079941 ACACCCTCCCAAGACTAAACCGG + Intergenic
943621971 2:190158832-190158854 GCCCACTCCCAACTCCAAACAGG - Intronic
1172455998 20:35073987-35074009 ACACCCTCCCAAGACTAAACTGG - Intronic
1175262584 20:57684158-57684180 GCCCCCTACCAAGTAAAAACCGG + Intronic
1178613761 21:34111717-34111739 GCCCCCTTCCAAGTCTAATTTGG + Intronic
949377949 3:3410762-3410784 ACACCCTCCCAAGTCTAAACCGG + Intergenic
949532390 3:4969179-4969201 CCACCCTCCCAAGACTAAACCGG + Intergenic
952721336 3:36536182-36536204 ACACCCTCCCAAGACTGAACTGG - Intronic
952999110 3:38915186-38915208 ACACCCTGCCAAGACTGAACTGG - Intronic
954175637 3:48843128-48843150 ACACTCTCCCAAGACTAAACTGG - Intronic
954833447 3:53443453-53443475 ACACCCTCCCAAGACTAAACCGG - Intergenic
956375037 3:68605216-68605238 ACACCCTCCCAAGACTGAATCGG + Intergenic
957306507 3:78464611-78464633 ACACCCTCCCAAGACAAACCAGG - Intergenic
957912518 3:86639114-86639136 ACACCCTCCCAAGACTGAACTGG - Intergenic
957952985 3:87148710-87148732 GCACCCTCACCAGTAAAAACTGG - Intergenic
959218243 3:103480870-103480892 ACACCCTCCCAAGACTAAACCGG - Intergenic
962464604 3:135645861-135645883 ACACCCTCCTAAGACTGAACTGG - Intergenic
965969944 3:174542606-174542628 GCACCCTCTGAAGTCTTATCTGG - Intronic
966080889 3:175998887-175998909 ACACCCTCCCAAGACTGAACAGG + Intergenic
967679479 3:192343563-192343585 TCACCCTCCCCATTCTCAACAGG + Intronic
969949107 4:10815604-10815626 GCACCCTCCCTAGACTAACAAGG - Intergenic
969952324 4:10850845-10850867 ACACACTCCCAAGTCTGAACAGG - Intergenic
970680138 4:18497597-18497619 ACACCCTCCCAAGATTAACCAGG + Intergenic
972742666 4:41903321-41903343 ACACCCTCTCAAGACTAAACCGG - Intergenic
972859565 4:43150657-43150679 ACACCCTCCCAAGACTAAACCGG - Intergenic
972914548 4:43859533-43859555 ACACCCTCCCAAGACTAAACCGG - Intergenic
974031243 4:56778770-56778792 GCACCATTCCAAGTCTACAGAGG + Intergenic
974539187 4:63211439-63211461 GCTCCCTCTCAAGTCTCTACTGG + Intergenic
974681017 4:65162034-65162056 ACAATCTCCCAAGACTAAACCGG + Intergenic
974814335 4:66985896-66985918 ACACCCTCCCAAGACTGAACCGG - Intergenic
975842581 4:78491084-78491106 ACGCCCTCTCAAGACTAAACCGG + Intronic
976060706 4:81124876-81124898 GGACCCCCACAATTCTAAACTGG - Intronic
976061023 4:81128545-81128567 ACACCCTCCCAAGGCTAAACCGG - Intronic
977185345 4:93929620-93929642 ACACCCTCCCAAGACTAACCAGG - Intergenic
977404517 4:96578606-96578628 ACACTCTCCCAAGACTAAACAGG - Intergenic
978743111 4:112161587-112161609 ACACCCTCCCAAGACTAAACCGG + Intronic
979006936 4:115311031-115311053 ATACCCTCCCAAGACTGAACCGG - Intergenic
979006944 4:115311072-115311094 ATACCCTCCCAAGACTGAACTGG - Intergenic
979496597 4:121391045-121391067 GCACCCTCCCTATTCTCTACTGG + Intergenic
979934355 4:126673013-126673035 AGACCCTCCCAAGACTAAACCGG + Intergenic
979967393 4:127091607-127091629 ACACCCTCCCAAGACTAATCTGG + Intergenic
980539989 4:134180807-134180829 ACAGCCTCCCAAGTTTGAACCGG + Intergenic
980803842 4:137787070-137787092 ACACCCTCCCAAGACTAAACCGG + Intergenic
981166060 4:141559015-141559037 GCAACCTCCCAAGATTGAACTGG + Intergenic
982614455 4:157623250-157623272 ACACCCTCCCAAGACTAAACCGG + Intergenic
982789103 4:159570035-159570057 ACACCCTCCCAAGACTGAACAGG - Intergenic
985317739 4:188676133-188676155 ACATCCTCCCAAGACTAAACCGG + Intergenic
986665032 5:10094732-10094754 ACACCCTCCCAAGACTAAACCGG + Intergenic
987669465 5:20988707-20988729 ACACCCTCCCAAGACTAAATGGG + Intergenic
987909843 5:24127035-24127057 ACACTGTCCCAAGACTAAACTGG - Intronic
989320401 5:40127780-40127802 ACATCCTCTCAAGACTAAACCGG - Intergenic
989349633 5:40471451-40471473 ACACCCTCCCAAGACCAAACCGG - Intergenic
989860923 5:46374665-46374687 ACACTCTCCTAAGACTAAACCGG + Intergenic
990317582 5:54598156-54598178 ACACCCTCCCAAGACTGAACTGG + Intergenic
990843231 5:60107285-60107307 ACACTCTCCCAAGACTAAACCGG + Intronic
990912202 5:60863675-60863697 ACACTCTCCCAAGACTAAACCGG + Intergenic
992038560 5:72805884-72805906 GCACCCTCCGAGGACTAAACTGG - Intergenic
992811562 5:80393839-80393861 ATGCCCTCCCAAGACTAAACCGG - Intergenic
994826581 5:104720503-104720525 ACACTCTCCCAAGACTAAACCGG + Intergenic
995529458 5:113078082-113078104 ACACCTTCCCAACACTAAACCGG + Intronic
997106951 5:131031430-131031452 ACACCCTCCCAAGACTAAACCGG - Intergenic
997401652 5:133608103-133608125 GCACCTTCCCAATTCTATAATGG - Intronic
999557101 5:152755371-152755393 ATACCCTCCCAAGACTAAACTGG + Intergenic
1001683598 5:173576483-173576505 GCAGCCTCCCAAAGCTGAACAGG - Intergenic
1001864749 5:175093735-175093757 GGAACCTCCCAGGTCTAAATTGG - Intergenic
1002996428 6:2289963-2289985 ACACCCTCCTAAGACTAAACCGG + Intergenic
1008529696 6:52445003-52445025 ACACCCTCCCAACACTAAACTGG - Intronic
1009634505 6:66248285-66248307 ACACCCTCCCAAGACTAAACCGG + Intergenic
1010334361 6:74663421-74663443 ACAGCCTCCCAAGACTAAACCGG + Intergenic
1010983121 6:82392130-82392152 ACACTCTCCCAAGACTAAACCGG - Intergenic
1011229850 6:85148317-85148339 ACACCCTCCCAAAACTAAACAGG - Intergenic
1011848173 6:91592234-91592256 ACTCCCTCCCAAGACTAAACTGG + Intergenic
1011858621 6:91726700-91726722 TGGCCCTCCCAAGACTAAACAGG - Intergenic
1012871195 6:104674497-104674519 ACACCCTCCCAAGACTAAACTGG + Intergenic
1013734980 6:113215076-113215098 ACACCCTCCCAAGACTAAACAGG - Intergenic
1014012365 6:116491123-116491145 ACACCCTCCCAAGACTAAACAGG + Intergenic
1014113681 6:117648964-117648986 ACACCCTCCCAAGTCTAAACTGG + Intergenic
1014475142 6:121862748-121862770 ATACCCTCCCAAAACTAAACCGG - Intergenic
1014817355 6:125950787-125950809 GCCCCCACCCAAATCTCAACCGG + Intergenic
1015179830 6:130349497-130349519 CATCCCTCCCAAGACTAAACCGG + Intronic
1015387280 6:132638573-132638595 ACACTCTCCCAAGAGTAAACCGG + Intergenic
1016423447 6:143909623-143909645 ACATCCTCCCAAGACTGAACAGG - Intronic
1016675575 6:146763117-146763139 GCACCTTCCCAACTGTATACAGG - Intronic
1017620860 6:156295180-156295202 GCAACATCCCAATTCTAAATTGG - Intergenic
1018984044 6:168622348-168622370 GCAGCCTCCCAAGCCAGAACAGG - Intronic
1019513318 7:1429184-1429206 CCTCCCTCCCAAAGCTAAACAGG + Intronic
1019924154 7:4181369-4181391 GCACACTCACAAGTCTAAAAGGG - Intronic
1021464361 7:20925066-20925088 ACAACCTCCCAAGACTAACCTGG - Intergenic
1021733746 7:23622294-23622316 ACACCCTCCCAAGACTAACCAGG - Intronic
1024019113 7:45349087-45349109 GCCCCCTCTCAAGTCTACAGTGG - Intergenic
1024170007 7:46775208-46775230 TCACCCTCCCAAAACAAAACTGG + Intergenic
1024397365 7:48885365-48885387 ACAACCTCCCAAGACTAAACCGG + Intergenic
1024893853 7:54233644-54233666 ACACCCTCCCAAGACTAAACTGG + Intergenic
1028200234 7:87952856-87952878 ACACCCTCCCAAGACTAAACCGG - Intronic
1028301745 7:89208723-89208745 CCACCGTGCCCAGTCTAAACAGG - Intronic
1029319406 7:99744808-99744830 AAACCCTCCCAAGACCAAACCGG + Intergenic
1029939293 7:104462954-104462976 ACACCCTCCAAAGACTGAACTGG - Intronic
1030572586 7:111246233-111246255 ACACTCTCCCAAGACTAAACCGG - Intronic
1031268756 7:119617582-119617604 ACACGCTCCCAAGGCTGAACCGG + Intergenic
1033859922 7:145612187-145612209 ACGCCCTCCCAAGACTAAACTGG - Intergenic
1034366550 7:150554561-150554583 ACACCCTCCCAAGACAGAACCGG + Intergenic
1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG + Intergenic
1036955524 8:13184029-13184051 ACACCCTCCAAAGACTAAACTGG - Intronic
1038707922 8:29912790-29912812 ACACACTCCCAAGACTAAACTGG + Intergenic
1041885590 8:62804041-62804063 ACACCCTCCCAAGATTAACCAGG + Intronic
1042457504 8:69022407-69022429 ACACTCTCCCAAGACTAAACCGG + Intergenic
1042622415 8:70721014-70721036 ACGCCCTCCCAAGACGAAACTGG - Intronic
1043048484 8:75356555-75356577 ATAACCTCCCAAGACTAAACCGG - Intergenic
1043279708 8:78448268-78448290 ACACCCTCCCAAGACTAAACCGG + Intergenic
1044377827 8:91497075-91497097 ACACCCTCCCAGGACTAAACCGG - Intergenic
1045103951 8:98872553-98872575 ACACCCTCCCAAGACTAAACTGG - Intronic
1046708707 8:117485671-117485693 ACAGCCTCCCAAGATTAAACCGG - Intergenic
1046955684 8:120060752-120060774 GCAGCCTCCTAAGTCTGTACAGG + Intronic
1047168920 8:122470873-122470895 ACACCCTCCCAAGACTGAGCTGG + Intergenic
1051045446 9:12867528-12867550 ACACCCTCCAAAGACTAAACCGG - Intergenic
1054381347 9:64493533-64493555 TTAACCTCCCAAGTTTAAACAGG - Intergenic
1055772705 9:79734669-79734691 ACACCCTCCCAAGACAAACCAGG + Intergenic
1059079845 9:111237027-111237049 GACCCCTCCCAGGTCCAAACTGG + Intergenic
1059600067 9:115767556-115767578 GAACTCTCCCCAGTCTAGACCGG - Intergenic
1186982453 X:14971707-14971729 ACACCCTCCCAAGACTAAACCGG - Intergenic
1186993240 X:15091827-15091849 ACACCCTCCCAAGGCTAAACCGG + Intergenic
1191012147 X:55771617-55771639 ACACCCACCCAAGACTAAACAGG - Intergenic
1191943227 X:66502212-66502234 GCACCCTACCCTGTCTGAACGGG + Intergenic
1192692408 X:73378093-73378115 GCACCCTTCCAAGACTAAACTGG + Intergenic
1192702016 X:73484542-73484564 TCACCCTACCAGGACTAAACTGG + Intergenic
1193025831 X:76844982-76845004 AGACTCTCCCAAGACTAAACCGG + Intergenic
1193095247 X:77541245-77541267 GCACCCTCCCAAGTCTAAACCGG + Intronic
1193209639 X:78791300-78791322 ACACTCTCCCAAGGCTTAACCGG + Intergenic
1193806859 X:86005690-86005712 ACACTCTCTCAAGACTAAACCGG + Intronic
1194232515 X:91341748-91341770 GCACCCTCCCAAGTCTCATTTGG + Intergenic
1195167329 X:102233194-102233216 ACACCCTCCCAAGACTAAACCGG - Intergenic
1195191530 X:102453893-102453915 ACACCCTCCCGAGACTAAACCGG + Intronic
1196584367 X:117412450-117412472 AAACACTCCCAAGACTAAACTGG + Intergenic
1197518075 X:127461415-127461437 ACACCCTCCTAAGACTGAACTGG - Intergenic
1198168673 X:134082883-134082905 ACACCCTCCCAAGACTAAACAGG + Intergenic
1199113590 X:143962614-143962636 ACACCTTCCCAAGACTGAACTGG - Intergenic
1200588804 Y:5043824-5043846 ACACTCTCCCAAGACTAAACCGG - Intronic
1200805660 Y:7431089-7431111 ACACCCTGCCAAGACTAACCAGG + Intergenic
1200981910 Y:9270313-9270335 CAACCCTACAAAGTCTAAACAGG + Intergenic
1201734391 Y:17242162-17242184 ACACCCTCCCAAGTCTAAACTGG - Intergenic
1201796092 Y:17898061-17898083 ACACCCTCCCAAGACTAAACAGG + Intergenic
1201800271 Y:17947534-17947556 ACACCCTCCCAAGACTAAACCGG + Intergenic
1201801282 Y:17958422-17958444 ACACCCTCCCAAGACTAAACCGG - Intergenic
1201805463 Y:18007924-18007946 ACACCCTCCCAAGACTAAACAGG - Intergenic
1202128506 Y:21589417-21589439 CAACCCTACAAAGTCTAAACAGG - Intergenic
1202248994 Y:22849956-22849978 ACACCCTCCCAAGACTAAACCGG - Intergenic
1202401982 Y:24483704-24483726 ACACCCTCCCAAGACTAAACCGG - Intergenic
1202468799 Y:25186379-25186401 ACACCCTCCCAAGACTAAACCGG + Intergenic