ID: 1193102974

View in Genome Browser
Species Human (GRCh38)
Location X:77636788-77636810
Sequence AAGAAGAAGGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7250
Summary {0: 6, 1: 46, 2: 268, 3: 1230, 4: 5700}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193102969_1193102974 23 Left 1193102969 X:77636742-77636764 CCTGTTGTTGGTTGCTATGCCAA 0: 1
1: 0
2: 1
3: 7
4: 85
Right 1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG 0: 6
1: 46
2: 268
3: 1230
4: 5700
1193102970_1193102974 4 Left 1193102970 X:77636761-77636783 CCAAAAAAAAAAAAAGAAGAAAG 0: 4
1: 292
2: 2755
3: 20138
4: 30687
Right 1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG 0: 6
1: 46
2: 268
3: 1230
4: 5700
1193102968_1193102974 24 Left 1193102968 X:77636741-77636763 CCCTGTTGTTGGTTGCTATGCCA 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG 0: 6
1: 46
2: 268
3: 1230
4: 5700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193102974 Original CRISPR AAGAAGAAGGAGAAGGAAGA AGG Intronic
Too many off-targets to display for this crispr