ID: 1193104016

View in Genome Browser
Species Human (GRCh38)
Location X:77648659-77648681
Sequence CTTTTTGCACAGATTAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193104015_1193104016 22 Left 1193104015 X:77648614-77648636 CCAAAGCTGCGTTTTTTTTTTTT 0: 1
1: 8
2: 116
3: 1195
4: 8567
Right 1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG 0: 1
1: 0
2: 5
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193104016 Original CRISPR CTTTTTGCACAGATTAATCA AGG Intronic
901821440 1:11832692-11832714 CTTATTACAAAGGTTAATCAAGG - Intronic
903634877 1:24805329-24805351 CTAATTGAACAAATTAATCATGG - Intronic
904948501 1:34216697-34216719 CAATTTGCACACATTCATCATGG + Intronic
905706957 1:40067678-40067700 CTGTTCGCGCAGATTAATCAGGG + Exonic
907539240 1:55197201-55197223 CTTTTTGAGTAGATTATTCAAGG - Intronic
908443361 1:64177692-64177714 CTTTTTGAGTATATTAATCAGGG + Exonic
909840501 1:80315661-80315683 CTTTTTGAACAAATGAATGAAGG + Intergenic
912989285 1:114468182-114468204 CTATGTGCACACATTAATAAGGG + Intronic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
913709791 1:121471455-121471477 CATTTTGCACATTTTAGTCAAGG + Intergenic
918661762 1:187097306-187097328 CTTTTGGCAAAAATAAATCACGG - Intergenic
918964532 1:191325018-191325040 CTTTTTTCACAAATTAAAGAGGG - Intergenic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
923800581 1:237205132-237205154 CTATTTGCACAGCAAAATCAAGG + Intronic
923867124 1:237951456-237951478 TTTTTTGCAGGGATTAATTAAGG + Intergenic
1064467760 10:15601639-15601661 CTTTTTTCACAGAAAAATTAAGG + Intronic
1065525620 10:26617356-26617378 CTTCTGACACAGATAAATCAAGG + Intergenic
1066266081 10:33776705-33776727 CTTTATGCAGAGAATAATTAAGG + Intergenic
1066287702 10:33984400-33984422 CTGTTTTCACTTATTAATCATGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1068201672 10:53791392-53791414 CTTTTTGCACATAATAATGTAGG + Intergenic
1069215585 10:65814952-65814974 CTAACTGCACAGATTAATCATGG + Intergenic
1071720125 10:88135282-88135304 CTTATAGCAAACATTAATCAGGG + Intergenic
1073807590 10:107115916-107115938 CTTTGTGCACTTTTTAATCAGGG - Intronic
1074133027 10:110599423-110599445 ATTTTTGTATAGTTTAATCATGG + Intronic
1074700289 10:116086562-116086584 CTTTTTGCACAAATGAGGCAGGG - Intronic
1077166412 11:1141438-1141460 CCTCTGGCACAGATTAATGAAGG - Intergenic
1079118374 11:17655702-17655724 CTTTTTTCAAAGCTTAATTAGGG - Intergenic
1081250295 11:40822934-40822956 CTTTCTCCACAGAATAATCTTGG + Intronic
1083076569 11:60045468-60045490 CTATTTTCACATATTAAGCAAGG - Intronic
1085566517 11:77519602-77519624 CATTTTGCAAAGATCAATAAGGG - Intronic
1090481826 11:127075741-127075763 CTTCTTGCCCAGATTTAACAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093659107 12:21733994-21734016 ATTTTTGCATTGATTCATCAAGG + Intronic
1095393483 12:41736866-41736888 CTTTTTTCACTGTTCAATCAAGG + Intergenic
1095691844 12:45098754-45098776 CTTTATCCAAAGATAAATCATGG + Intergenic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1098599731 12:72316740-72316762 TTTTTTAAATAGATTAATCATGG - Intronic
1099520225 12:83650802-83650824 GTTTTTCCACAGATTCATCTAGG + Intergenic
1100833003 12:98536332-98536354 CTTTTTGTAGACATTTATCATGG - Intronic
1101526923 12:105539259-105539281 CTTTCTGCACATAGTACTCATGG + Intergenic
1104229225 12:126867736-126867758 CTTTTTGTACTTATTAATCCTGG - Intergenic
1104764152 12:131315668-131315690 CTTATTTCAGAGAATAATCAGGG - Intergenic
1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG + Intronic
1108437756 13:50417292-50417314 TTTTTTGCACACATGAATCTGGG + Intronic
1111286033 13:86093006-86093028 TCTATTGGACAGATTAATCAAGG + Intergenic
1114570995 14:23668475-23668497 TTGGTTGCACAGATTAATCATGG + Intergenic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1115109504 14:29804303-29804325 CTTTTTGAACAGTTTACTCTTGG - Intronic
1120504949 14:85343992-85344014 CATTTTGCATAAATAAATCAAGG + Intergenic
1121501032 14:94437842-94437864 CTTATTACACAGAATGATCAAGG - Intergenic
1121722776 14:96122501-96122523 CATTTTGGAAAGATTAATCACGG + Intergenic
1125051997 15:35310328-35310350 CTTTTTGCACATCTTAAAAAGGG + Intronic
1127018519 15:54717824-54717846 CTTTCAGCACAAATTAATTAAGG + Intergenic
1127175690 15:56353267-56353289 ATTTTTTAACAGATTAGTCATGG - Intronic
1131232797 15:90671823-90671845 CTTTTTGGACAGTTCAATTAGGG - Intergenic
1135241735 16:20813171-20813193 CTTTCTGCAAAGATTAATCAGGG - Exonic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1139146674 16:64333088-64333110 ATTTTTGCATATATTCATCAGGG - Intergenic
1139925782 16:70485514-70485536 CTTTTAACATAGATAAATCATGG + Intronic
1140999740 16:80297254-80297276 CATTTTGCCCAGAATAATTAGGG + Intergenic
1142181625 16:88673977-88673999 ATTTTGGCCCAGAATAATCATGG - Intergenic
1144952140 17:19000135-19000157 GTTTTTTCCCAGATAAATCATGG + Intronic
1149301668 17:55310066-55310088 CTTTTGTCACAGATTAGGCAAGG - Intronic
1149363621 17:55918979-55919001 CTTCTTACCCAGATTACTCAGGG - Intergenic
1150665537 17:67133085-67133107 TTATTTGTACAGTTTAATCATGG - Intronic
1156262802 18:35460287-35460309 CTTTTTACTCAGAGTAAGCAGGG - Intronic
1156634986 18:39016675-39016697 TTTTTTGCCCAGATCCATCAGGG + Intergenic
1158163830 18:54516953-54516975 CTTTTTTCTCTGATTACTCATGG + Intergenic
1159879352 18:73843970-73843992 GTTTTTGCACAGATGAATCACGG + Intergenic
1159940560 18:74403966-74403988 CTCTTTGCACATATTACTTAGGG + Intergenic
1164320076 19:24136762-24136784 CTTTTTTTTCAGATAAATCAGGG + Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
927976778 2:27344652-27344674 CTTTCTGTAAAGATTAGTCAAGG + Intronic
928267805 2:29826698-29826720 TTTATTGCTCTGATTAATCATGG - Intronic
929713815 2:44291183-44291205 TTTTCTGCACAGATTTGTCAAGG + Intronic
931755597 2:65371362-65371384 CTGTTTGAACAGATTAAACTGGG + Intronic
937755610 2:125534270-125534292 GCCTTTGCACAGATTAATCCTGG + Intergenic
938419320 2:131131571-131131593 CTTTTCTTACAGATTAATAAAGG - Intronic
940326257 2:152428345-152428367 TTTTATGTACAGATTTATCATGG + Intronic
940536109 2:154946700-154946722 CTATTTGCACAGTCTAATTATGG + Intergenic
945708749 2:213269184-213269206 CCTTTTACAGAGATTAAACAAGG - Intergenic
946503074 2:220270404-220270426 ATTTTTAAAGAGATTAATCATGG - Intergenic
947486963 2:230559375-230559397 TTGTTTGTACAGATTCATCATGG - Intergenic
1170103468 20:12727899-12727921 CTTTTTGCAGGGATTATTTATGG - Intergenic
1170827374 20:19808522-19808544 CTATTTGCACAGCAAAATCAGGG + Intergenic
1173260856 20:41434230-41434252 ATTTATGCAAACATTAATCAAGG + Intronic
1177131828 21:17267127-17267149 ATTTTTTCAAAGGTTAATCATGG - Intergenic
1177705422 21:24698183-24698205 CTTATTCCACAGATTAAACCAGG - Intergenic
1183915256 22:41112807-41112829 CTTTATGGAAAGATTAACCAAGG + Intronic
949859984 3:8496199-8496221 CTTCTTTGACAGATTAATAAGGG - Intergenic
951941820 3:28087688-28087710 CTATTTGCACACATAAATGAGGG + Intergenic
954882019 3:53842989-53843011 TCTTTTGCAAATATTAATCAAGG - Intronic
955093968 3:55778852-55778874 CTTCTTGGAAAGTTTAATCAAGG + Intronic
955760543 3:62276382-62276404 CTAGTTGTACAGATTAATCCAGG - Intronic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
957639322 3:82831008-82831030 CTTTTCGCATAGAATTATCATGG - Intergenic
958962569 3:100523854-100523876 CTTTTTGAACAGAGTTATCTGGG + Intronic
959442841 3:106399876-106399898 CTTCTTGCACAGATTCCTAAAGG - Intergenic
959485140 3:106920084-106920106 CTTTTTGAAAAGACTAATAAAGG + Intergenic
962918661 3:139932174-139932196 CTTGTTGCAAAGATTAAAGAAGG + Intergenic
963196878 3:142542330-142542352 CTTTTGGCTCAGATTCATCTGGG - Intronic
965973553 3:174592722-174592744 ATTGTTACACAGATTAATAATGG - Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
968855329 4:3116010-3116032 CTTTTTTAACAGATTAAGCCGGG + Intronic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
973958874 4:56089913-56089935 CTTTTTATACAGACTAATGATGG - Intergenic
975191503 4:71468273-71468295 CTTTGTGGAAAGATTAAACAAGG + Intronic
976597669 4:86909150-86909172 CTTTTAACACAAATTATTCAGGG + Intronic
977856266 4:101898322-101898344 CTTTATACATATATTAATCAAGG + Intronic
977918277 4:102617303-102617325 GTATTTGCACAGATCAAACAAGG - Intergenic
978988778 4:115050939-115050961 CTATTTTCACTGATTAATCCGGG - Intronic
980216978 4:129865014-129865036 ATTTTTGAAAAGATTAATCATGG - Intergenic
980971939 4:139575161-139575183 CTTCTTTCACAGATAAACCAAGG - Intronic
980999329 4:139813343-139813365 CTTTTTGCACCCATTGTTCAGGG - Intronic
982154724 4:152507461-152507483 CATTTTGCACTGATTAATCCTGG - Intronic
982991376 4:162280337-162280359 TTATTTATACAGATTAATCAGGG + Intergenic
984228189 4:177061567-177061589 CATTTTGCAAAGTATAATCAAGG + Intergenic
984474329 4:180216811-180216833 CTATTTGCACAGCAAAATCAGGG - Intergenic
985278140 4:188258828-188258850 CTTTGCACACAGAATAATCAAGG - Intergenic
989222213 5:38980158-38980180 CTTCTTGAACAAATTAATCGGGG + Intronic
989486038 5:41993570-41993592 CTTTTTACCCATATTAGTCAGGG + Intergenic
990973180 5:61532247-61532269 CATTAGGCACAGATTCATCAAGG + Intronic
993559930 5:89393715-89393737 CTTTTTAAAAAGAATAATCAGGG + Intergenic
994971908 5:106750024-106750046 CTTTCTGCATTGATTAATCATGG - Intergenic
996184113 5:120455785-120455807 CTTTCTATACAGAATAATCAAGG + Intergenic
996505996 5:124268147-124268169 GTTCTTGCACAGATTAATTTTGG + Intergenic
999914744 5:156245521-156245543 ATTTTTGTTAAGATTAATCATGG - Intronic
1000927922 5:167216282-167216304 TTTTTTTCACAGATTATTTATGG + Intergenic
1008254873 6:49285208-49285230 CATTTTGTAATGATTAATCAGGG + Intergenic
1008710069 6:54214382-54214404 CTTATTCCCCAGATTTATCAGGG + Intronic
1010108719 6:72199026-72199048 CTTTTTGCACATGTCATTCAGGG - Intronic
1010904067 6:81464517-81464539 CTTTTTGGACAAATTAAAGAAGG - Intergenic
1014037591 6:116785399-116785421 CTTTAGGCACAGCTAAATCAGGG + Intergenic
1014451825 6:121590964-121590986 TATTTTCCACAGAGTAATCAGGG + Intergenic
1016121533 6:140347997-140348019 ATTTTTTCACAGAGTAATAATGG - Intergenic
1016707313 6:147125001-147125023 CTTTTTGCTCAGATTAACTTTGG + Intergenic
1018715185 6:166526932-166526954 CTCTGTGTACAGAATAATCATGG - Intronic
1020512372 7:9073883-9073905 CTCTGTGCACATATTTATCAGGG - Intergenic
1021421226 7:20447100-20447122 CTTTTTGTAAAACTTAATCATGG + Intergenic
1024421534 7:49172923-49172945 CTTTTTGTACAGATGCATTAAGG - Intergenic
1027795586 7:82689875-82689897 CTTTTTCCACAGCTTAACCAAGG - Intergenic
1027795815 7:82691822-82691844 CTTTTTCCACAGCTTAACCAAGG - Intergenic
1028925828 7:96356008-96356030 CATTTTGCACAGGGTATTCAGGG - Intergenic
1029050520 7:97681735-97681757 ATTGTTGGACAGATTAATGAAGG + Intergenic
1029236852 7:99127256-99127278 CTTTTTGCACATACGGATCAGGG - Intronic
1030241469 7:107331159-107331181 CTTATAGCACAGCTTGATCATGG - Intronic
1031529325 7:122857016-122857038 GTTTTTGCAGATATTCATCATGG + Intronic
1036741586 8:11366875-11366897 CCAGTTCCACAGATTAATCATGG + Intergenic
1037948065 8:23001632-23001654 CTCTTGGCACAAATTAACCACGG + Intronic
1039143466 8:34419407-34419429 TTTTTTACATAGATTAATTATGG + Intergenic
1040797740 8:51304786-51304808 CGTTTTTCACACATTAATCTTGG - Intergenic
1041939513 8:63371213-63371235 CTTTTTGCTGAGGTTAATTAAGG - Intergenic
1042592634 8:70411931-70411953 ATTTGTGCACAGTTTATTCATGG + Intergenic
1043376022 8:79650761-79650783 ATTTTTGAACAAATTATTCAGGG - Intronic
1045831934 8:106472226-106472248 CTTTTTGCACAAATGCATCCTGG - Intronic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1047182657 8:122604310-122604332 CTTTGTGTACAGATTGATCATGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1049815455 8:144597076-144597098 CCTTGGGCACAGATTAACCAGGG - Intronic
1052225839 9:26084862-26084884 CTTTTTCCACATATAATTCAAGG - Intergenic
1052450329 9:28621664-28621686 GTTTTTGCACATATTAATAAAGG + Intronic
1053341985 9:37344855-37344877 TTTTTTGAACAAATTAATGAAGG + Intronic
1054740581 9:68802239-68802261 CTTTTAGCACTGGATAATCAAGG - Intronic
1054769163 9:69068313-69068335 CTGTTTGCACAGCAAAATCAGGG + Intronic
1055126516 9:72724623-72724645 CTTTTTAGATAGATAAATCATGG + Intronic
1055485495 9:76752701-76752723 CATTTTGGACAGGTTAATAATGG + Intronic
1057455638 9:95207443-95207465 TTATTTGCACAGGTTAAGCAAGG + Intronic
1060028671 9:120195087-120195109 CTTTTTGCACTGATTATTTTTGG - Intergenic
1186103927 X:6185757-6185779 ATTATTGCACAGATTGATCTTGG - Intronic
1186119397 X:6343141-6343163 CTTTATGCAGAGATCAAACATGG + Intergenic
1186628829 X:11326007-11326029 CTTGTTGCACAGATTAAACTGGG - Intronic
1186987739 X:15035243-15035265 ATTTTTGCTCATTTTAATCATGG - Intergenic
1187015549 X:15324419-15324441 CTTTATGCCCAGTTTAATGAGGG + Intronic
1187266598 X:17739267-17739289 CATTTTGCACAGTGTAGTCATGG + Intronic
1187665889 X:21609034-21609056 ATTTTGGCACAGACTAATCAGGG + Intronic
1189056649 X:37706341-37706363 GTTTTTGAAGAGAATAATCAAGG + Intronic
1189219746 X:39361421-39361443 CTTTTTGCATAGACAAATAAGGG + Intergenic
1191015346 X:55803967-55803989 CTTTTTTCACTGATTCATCATGG - Intergenic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1193630107 X:83875081-83875103 TTTTTTGCACAGTTGAATCTTGG - Intronic
1194704463 X:97157966-97157988 CTTTCTACAGATATTAATCAAGG + Intronic
1196036643 X:111152180-111152202 CATTTTGCAGATATTAATGAAGG - Intronic
1196383779 X:115124685-115124707 GTTGTTGCACAGATTAAATAAGG - Intronic
1197465445 X:126799303-126799325 AGTATTGCACAGATTACTCAGGG - Intergenic
1197680473 X:129377525-129377547 CTTTTTGCACAGTCTACTTAAGG - Intergenic
1199185208 X:144908500-144908522 TTTTTTGCACGGTTTCATCAAGG + Intergenic