ID: 1193112524

View in Genome Browser
Species Human (GRCh38)
Location X:77743818-77743840
Sequence GTAACTGTGTTGGCAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193112524_1193112529 4 Left 1193112524 X:77743818-77743840 CCTGGAACTGCCAACACAGTTAC 0: 1
1: 0
2: 1
3: 42
4: 152
Right 1193112529 X:77743845-77743867 ACACACTGCCCCAGGGCACATGG 0: 1
1: 0
2: 7
3: 43
4: 345
1193112524_1193112526 -4 Left 1193112524 X:77743818-77743840 CCTGGAACTGCCAACACAGTTAC 0: 1
1: 0
2: 1
3: 42
4: 152
Right 1193112526 X:77743837-77743859 TTACCAGCACACACTGCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 181
1193112524_1193112527 -3 Left 1193112524 X:77743818-77743840 CCTGGAACTGCCAACACAGTTAC 0: 1
1: 0
2: 1
3: 42
4: 152
Right 1193112527 X:77743838-77743860 TACCAGCACACACTGCCCCAGGG 0: 1
1: 0
2: 3
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193112524 Original CRISPR GTAACTGTGTTGGCAGTTCC AGG (reversed) Intronic
906553027 1:46682177-46682199 GTCACTCTGTTGGAATTTCCTGG - Intronic
906880199 1:49581775-49581797 GCATCTGTGTTGGGAGTTCTAGG + Intronic
909268827 1:73597447-73597469 GTACGTTTGTTAGCAGTTCCCGG - Intergenic
909299330 1:73991760-73991782 GTAGGTTTGTTAGCAGTTCCTGG - Intergenic
910750007 1:90619031-90619053 GTACGTTTGTTAGCAGTTCCCGG + Intergenic
913956512 1:143302300-143302322 GAAAATATGTTGGGAGTTCCTGG - Intergenic
914075293 1:144339795-144339817 GAAAATATGTTGGGAGTTCCTGG + Intergenic
914103885 1:144626701-144626723 GAAAATATGTTGGGAGTTCCTGG - Intergenic
917215392 1:172672941-172672963 GCAACTGGGGTGGCAGTTTCAGG - Intergenic
918764539 1:188461987-188462009 GTATGTGCGTTAGCAGTTCCTGG + Intergenic
919576037 1:199310978-199311000 GGAAAGGTGTGGGCAGTTCCTGG - Intergenic
920222990 1:204417820-204417842 GGAACTGTGGTGGGAGTGCCTGG - Intergenic
923839264 1:237650374-237650396 GTAATTGTGTTGGGAGTCCTTGG + Intronic
924697441 1:246415175-246415197 GTATCTGTGTTAACAATTCCAGG - Intronic
1063247929 10:4242524-4242546 GTCACTGTGGTGACAGTTTCAGG + Intergenic
1063548850 10:7009108-7009130 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1065974807 10:30833128-30833150 TTAACTGTGGTGGCTGTCCCTGG - Intronic
1066781663 10:38954961-38954983 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1068137402 10:52964662-52964684 GCAACAGGGTGGGCAGTTCCAGG + Intergenic
1068683792 10:59848148-59848170 GAACCTGTCTTGGCAGTTCTGGG - Intronic
1071566166 10:86672466-86672488 GTAGCTGTGCCGGCAATTCCTGG + Intronic
1071969431 10:90888087-90888109 GAAACTGTATTGGCAGTTTGAGG - Intronic
1072042342 10:91620204-91620226 GTACATTTGTTAGCAGTTCCTGG + Intergenic
1074444514 10:113508801-113508823 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1075861169 10:125678462-125678484 GCACCTGTTTTGGCAGTTCTTGG + Intronic
1077573500 11:3358175-3358197 GTAACTGTGCAGACAGTTACAGG - Intronic
1080486608 11:32714544-32714566 GCTACTGTGCTGGCAGTTCTTGG - Intronic
1080602404 11:33832490-33832512 GTATGTTTGTTAGCAGTTCCTGG - Intergenic
1082139909 11:48596655-48596677 TTAACTGTATTTGCAGTTACTGG - Intergenic
1082732492 11:56817194-56817216 GTACATCTGTTAGCAGTTCCTGG - Intergenic
1086837613 11:91644699-91644721 GTAACTGTGTGCGCAGTAACAGG - Intergenic
1088356252 11:108946941-108946963 GTATGTTTGTTAGCAGTTCCTGG + Intergenic
1090247791 11:125229100-125229122 GGAGCGGTGTTGGCATTTCCTGG + Intronic
1093272446 12:17081330-17081352 GGAACAGGGTTGGCAGGTCCAGG + Intergenic
1093622341 12:21306740-21306762 GTAACTCCTTTGGAAGTTCCTGG + Intronic
1094099379 12:26744459-26744481 GTTGCTGTGTTTGCAGTGCCAGG - Intronic
1095131135 12:38543846-38543868 TCAACTGTGTTGTAAGTTCCTGG - Intergenic
1095298081 12:40549931-40549953 TTACCTGTGTTGGAACTTCCAGG - Exonic
1100532763 12:95475350-95475372 GTTACTCTGGTGGCTGTTCCTGG + Intronic
1104233460 12:126908138-126908160 GGAAAGGTGTGGGCAGTTCCTGG + Intergenic
1104570861 12:129924580-129924602 GTAAATGTGTCTGCAGTGCCGGG + Intergenic
1107187688 13:37544080-37544102 GTAAATTTGTTAGCAGTTCCTGG + Intergenic
1107671006 13:42746217-42746239 GTAACTGTGTTGGCTGCTTTGGG + Intergenic
1108030554 13:46224983-46225005 GCACCTGTGTTGGCAGTTACTGG + Intronic
1108453284 13:50588161-50588183 GGAACTGTGTGGGCAGTTCATGG + Intronic
1108862743 13:54882310-54882332 GTAACTGTCCAGGCAGTTACAGG + Intergenic
1111420522 13:88005136-88005158 GCACCTGAGGTGGCAGTTCCAGG + Intergenic
1111549107 13:89784200-89784222 GAAGCTGGGTTGCCAGTTCCGGG - Intergenic
1117748646 14:58897938-58897960 GTAAATTTGGTGTCAGTTCCTGG + Intergenic
1118490765 14:66257328-66257350 GTATGTTTGTTAGCAGTTCCTGG + Intergenic
1120100067 14:80434842-80434864 GTAACTCAGCTTGCAGTTCCAGG + Intergenic
1202938926 14_KI270725v1_random:123976-123998 GAAAATATGTTGGGAGTTCCTGG - Intergenic
1123394212 15:19912301-19912323 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1123633879 15:22283112-22283134 GTAACTGTTTTGACAATTTCGGG + Intergenic
1126238505 15:46413960-46413982 GTAACTGGTTTGGCATTTCCTGG + Intergenic
1130539143 15:84809446-84809468 GTAACTGTGGCAGCAGTTGCTGG + Intergenic
1130687719 15:86053712-86053734 ATAACTGTGTTGGCACCCCCTGG + Intergenic
1132005105 15:98219398-98219420 GTAACTGAATGGGAAGTTCCTGG + Intergenic
1132008121 15:98249376-98249398 GGAACTGAGATGGCAGTTGCTGG + Intergenic
1132338015 15:101061136-101061158 GAAACTGTGCTGTCAGTGCCCGG - Intronic
1134117714 16:11561683-11561705 CTAACCGTGGTGGCATTTCCTGG - Intronic
1136767418 16:32797273-32797295 GAAAATATGTTGGGAGTTCCTGG - Intergenic
1136800730 16:33073428-33073450 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1136863681 16:33722440-33722462 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1136868861 16:33783351-33783373 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1137085548 16:36117575-36117597 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1137682293 16:50359956-50359978 GTAAATGTGTTTGTAGTTCATGG - Intronic
1203069812 16_KI270728v1_random:1059295-1059317 GAAAATATGTTGGGAGTTCCTGG - Intergenic
1203103313 16_KI270728v1_random:1332717-1332739 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1203125165 16_KI270728v1_random:1570586-1570608 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1144044181 17:11440038-11440060 TTAACTGTGTTAGCAGACCCAGG - Intronic
1145324516 17:21791685-21791707 GAAAATGTGTTGGTAGTTCCTGG - Intergenic
1145326089 17:21827124-21827146 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1145710919 17:26975399-26975421 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1148196530 17:45717254-45717276 GTAACTGTGTTACCTGTTCCAGG - Intergenic
1148862847 17:50613527-50613549 CTGACTCTGTAGGCAGTTCCAGG - Intronic
1203182337 17_KI270729v1_random:72262-72284 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1203190282 17_KI270729v1_random:177757-177779 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1153325692 18:3817900-3817922 ATTACTGTGGTGGCAGTTTCAGG + Intronic
1154235646 18:12603297-12603319 GTAACTGTGTTTGCTTTTCTGGG + Intronic
1154516907 18:15180058-15180080 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1154936857 18:21068434-21068456 GAAACTGTTTTGGCTGTTCCAGG + Intronic
1155242119 18:23873425-23873447 TTAACTGTCTCGGCATTTCCAGG - Intronic
1157953664 18:52069740-52069762 TTAACTGTGTTGAAAGTTTCTGG - Intergenic
1164823915 19:31270243-31270265 GTAAGTGTGTTTCCAGTTCATGG - Intergenic
1168563892 19:57406497-57406519 GTACCTGTGTTGGCAGTTCTAGG + Intronic
1202668522 1_KI270709v1_random:24177-24199 GAAATTGTGTTGGGAGTTCCTGG + Intergenic
925964728 2:9053382-9053404 GTATCCGTGTTGCCAGTACCTGG + Intergenic
929242729 2:39668139-39668161 CTAACTGAGGTGCCAGTTCCAGG + Intronic
930668306 2:54121387-54121409 GAAACCGAGTTGCCAGTTCCAGG - Intronic
932089791 2:68796739-68796761 GCACCTGTACTGGCAGTTCCAGG + Intronic
932513174 2:72316401-72316423 GGAACTTAGGTGGCAGTTCCTGG - Intronic
933048831 2:77575654-77575676 TTGACTGTGTTGGAAGTTCTAGG + Intronic
934252781 2:90375719-90375741 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
934256660 2:91427228-91427250 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
935603360 2:104945364-104945386 GAAACTGAGCTGGCTGTTCCTGG - Intergenic
936774512 2:115956689-115956711 GTACATTTGTTGGCAGTTCCTGG + Intergenic
938517236 2:132025027-132025049 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
941759079 2:169220975-169220997 TCAACTGTGTTGGCAGTAACTGG - Intronic
944550899 2:200844162-200844184 GTATGTTTGTTAGCAGTTCCTGG + Intergenic
947899115 2:233705613-233705635 GAAACTGAGTTGACAGTTCTAGG + Intronic
948082325 2:235216374-235216396 GTAACTGGGTTGATAGTTCAAGG + Intergenic
948286922 2:236793260-236793282 GGAACTGCGCTGGCAGCTCCAGG + Intergenic
949003109 2:241628611-241628633 GTGACTGTTGTGGCAGTCCCAGG - Intronic
1171878364 20:30598685-30598707 GTAAGTGTATTGGCTGTGCCAGG - Intergenic
1173194696 20:40904768-40904790 GTGACTGTGGTGGCTTTTCCTGG - Intergenic
1173322485 20:42001010-42001032 GCACCTGTGTTGGCAGTTACTGG + Intergenic
1173874107 20:46358936-46358958 GTCACTTTGGTGGCAGTTCATGG - Intronic
1176272827 20:64245324-64245346 GAAACTGTGATGCCAGTTACTGG - Intergenic
1176584329 21:8563553-8563575 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1177361480 21:20077954-20077976 GTAAGTTTGTTAGCAGTTCCTGG - Intergenic
1178741461 21:35205946-35205968 GGAACTGTGCTGGCATTTCTGGG + Intronic
1180267141 22:10540457-10540479 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1181535345 22:23539515-23539537 GTATCTGAGTTGGCATTGCCGGG - Intergenic
1184425671 22:44407819-44407841 GTAAGTGGGTTGGCAGTGCATGG + Intergenic
1203288289 22_KI270735v1_random:5290-5312 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1203326117 22_KI270738v1_random:21196-21218 GAAAATGTTTTGGGAGTTCCTGG - Intergenic
949249431 3:1965200-1965222 TTAACTGTGTTGGCAAATTCGGG - Intergenic
949938253 3:9134269-9134291 GTAACTGTTCTGGCACCTCCTGG + Intronic
950729564 3:14946012-14946034 GTATGTTTGTTAGCAGTTCCTGG + Intergenic
951449538 3:22820761-22820783 AAAACCGTGTTGGCTGTTCCTGG - Intergenic
952232163 3:31443532-31443554 GAATCTGTGTTGGCAGTTCTGGG - Intergenic
952420249 3:33124012-33124034 GTAACTATGATGGCAGTTACAGG - Intronic
958427154 3:93992333-93992355 TCAACTGAGTCGGCAGTTCCTGG - Intronic
961808848 3:129509457-129509479 GTATGTTTGTTAGCAGTTCCTGG + Intronic
964003534 3:151805842-151805864 GTAACTGTCTGACCAGTTCCCGG + Intergenic
964563737 3:158026176-158026198 GGAACTATGTCGGCAGTACCTGG + Intergenic
966235696 3:177699591-177699613 GTCACTTTGTTAGCAGTTCCCGG + Intergenic
968709503 4:2102617-2102639 GCACCTGTATTGGCGGTTCCAGG - Intronic
970285746 4:14512526-14512548 GTACATTTGTTAGCAGTTCCTGG - Intergenic
970942831 4:21655376-21655398 TAAAATGTGTTGGCAGTTTCTGG - Intronic
971583257 4:28370757-28370779 GTATCTGTGTTATCAGTTTCAGG + Exonic
980740942 4:136949263-136949285 GCACCTATGTTGGCATTTCCAGG + Intergenic
980786542 4:137563464-137563486 ATAACTGTATTTGCAGTTCCTGG + Intergenic
981930367 4:150182993-150183015 TTAACTGTGTTGGCAGGTGGTGG - Intronic
982028513 4:151276410-151276432 GTGGCTCTGTTGGCAGTTCTTGG - Intronic
984968668 4:185166306-185166328 GTAACTGTGCAGGAACTTCCTGG + Intronic
985514624 5:335133-335155 GCACCTGTGTTGGCAGTACCAGG + Intronic
985876494 5:2602593-2602615 GCAGCTGTGCTAGCAGTTCCTGG - Intergenic
986411425 5:7484486-7484508 GTTACTTTCTGGGCAGTTCCAGG - Intronic
988575557 5:32420011-32420033 GTAACTGTGTGAGCAGCTACTGG + Exonic
989338692 5:40349310-40349332 GCACCTGTGTTGGCAGTTACTGG - Intergenic
990964056 5:61425571-61425593 ATAACTGTGTTCCCATTTCCAGG - Intronic
992084838 5:73269233-73269255 TTAACTGTATTGGTTGTTCCAGG + Intergenic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
994432566 5:99686561-99686583 GTATGTTTGTTAGCAGTTCCTGG - Intergenic
998910169 5:146951284-146951306 TTAACTGTGTTGGTGGTTACTGG - Intronic
999964344 5:156792537-156792559 GTACCTTCGTTAGCAGTTCCTGG - Intergenic
1003948710 6:11098093-11098115 GGAACTGTGTTCCCAGTTCCTGG - Intronic
1004023024 6:11791393-11791415 GTAACTGTCCAGGCAGTTACAGG + Intronic
1004829757 6:19464162-19464184 GTCAGTGTGTGGGAAGTTCCTGG + Intergenic
1005677637 6:28171625-28171647 ATAAGTGTCTTGGCTGTTCCTGG + Intergenic
1008875505 6:56321648-56321670 GTACCTTTGTTAGCAGTTTCTGG - Intronic
1010460151 6:76105243-76105265 GTAACTGCTCTGGCAGTTCTTGG + Intergenic
1013572117 6:111439317-111439339 GTACATTTGTTAGCAGTTCCTGG - Intronic
1013638887 6:112054022-112054044 GTGACTGTGTTACCTGTTCCTGG - Intergenic
1014263891 6:119252461-119252483 GTATGTTTGTTAGCAGTTCCTGG - Intronic
1014864998 6:126518334-126518356 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1016076652 6:139804411-139804433 GCAGCTGTGTGGGCAGCTCCAGG + Intergenic
1017145308 6:151229472-151229494 GGAAAGGTGTGGGCAGTTCCAGG - Intergenic
1019121504 6:169808469-169808491 GTACCTGGGTTGTCAGTACCTGG - Intergenic
1020695894 7:11413821-11413843 GGAACTGGGTTGGCAGGTCCAGG - Intronic
1021236167 7:18144774-18144796 GTCACTGTGCTAGCAGTTTCTGG + Intronic
1025319031 7:58071706-58071728 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1025477443 7:60942186-60942208 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1025482830 7:61005534-61005556 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1025554687 7:62291478-62291500 GAAAATGTGTTGGGAGTTCCTGG - Intergenic
1025560094 7:62361798-62361820 GAAAATGTGTTGGGAGTTCCTGG + Intergenic
1025562955 7:62393369-62393391 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1025877354 7:65495268-65495290 GAAAATGCGTTGGGAGTTCCTGG - Intergenic
1027885859 7:83904109-83904131 GCACCTGGGTTGGCAGTGCCTGG - Intergenic
1031961686 7:127995816-127995838 TTAACTGTCTTCACAGTTCCAGG + Intronic
1035136097 7:156704147-156704169 GCGCCTGTGTTGGCAGTTCCAGG - Intronic
1039924095 8:41913474-41913496 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1040060897 8:43102052-43102074 GTAACTGTGTAGGAACTCCCTGG - Intronic
1042447522 8:68903718-68903740 GTAAATATGTTGGCATTTTCAGG + Intergenic
1042674170 8:71301081-71301103 ATAAATGTGTTGGCAGTTCAAGG + Intronic
1047257881 8:123229533-123229555 GCACCTGTGCTGGCAGTTACAGG + Intronic
1047886633 8:129258097-129258119 GTATCTGTGTTGGCTGTTTAGGG + Intergenic
1048099756 8:131337905-131337927 GTAGGTTTGTTAGCAGTTCCTGG - Intergenic
1049104924 8:140606340-140606362 TTAACACTGTTGGCAGTTCTTGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1055167047 9:73209646-73209668 GTATGTTTGTTAGCAGTTCCTGG - Intergenic
1056038824 9:82638037-82638059 GCACCTGTGTTGGCAGTTATGGG - Intergenic
1057053548 9:91944344-91944366 ATGACTGTATTGGAAGTTCCAGG + Intronic
1058311512 9:103509604-103509626 GTAAGTTTGTTAGCAGTTCCTGG - Intergenic
1059026100 9:110632807-110632829 GTAGGTTTGTTAGCAGTTCCTGG - Intergenic
1059563147 9:115354822-115354844 GTACGTTTGTTAGCAGTTCCTGG - Intronic
1203614234 Un_KI270749v1:41083-41105 GAAAATATGTTGGGAGTTCCTGG + Intergenic
1190518599 X:51252095-51252117 CAAACTGTGTTTGCATTTCCAGG + Intergenic
1193112524 X:77743818-77743840 GTAACTGTGTTGGCAGTTCCAGG - Intronic
1193249368 X:79270479-79270501 GTTCCTGTGTAGGCAGTTACAGG - Intergenic
1197361424 X:125508351-125508373 GTATGTTCGTTGGCAGTTCCTGG + Intergenic
1198787463 X:140304308-140304330 GCACCTGTGTTGGCAGTTATAGG - Intergenic
1201274957 Y:12287991-12288013 GTAACTGTGCAGACAGTTACAGG - Intergenic
1201385191 Y:13432671-13432693 GCATCTGTATTGGCAATTCCAGG - Intronic