ID: 1193113068

View in Genome Browser
Species Human (GRCh38)
Location X:77749002-77749024
Sequence TCGTACATGCATATATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 2, 2: 8, 3: 28, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193113068 Original CRISPR TCGTACATGCATATATTGCA TGG Intronic
907196914 1:52694497-52694519 TGTTACATGGATATATTGCCTGG - Intronic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908729008 1:67207248-67207270 TGTTACCTGGATATATTGCATGG + Intronic
909603253 1:77482638-77482660 TGGTACATGCCTGTATTGCCAGG + Intronic
909898039 1:81098582-81098604 TTGTAGATCCATATATTGTATGG - Intergenic
911344422 1:96679195-96679217 TTGTAGAGCCATATATTGCATGG - Intergenic
912533326 1:110341806-110341828 TCCAACATGCATCTGTTGCAGGG + Exonic
912613070 1:111068327-111068349 TGTTACATGTATAAATTGCATGG + Intergenic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
923579296 1:235192433-235192455 TCCTACATGCAAATAGTGCATGG - Intronic
924022249 1:239796738-239796760 TGTTACATGGATATATTGCATGG + Intronic
924368570 1:243322376-243322398 TAGTAGATGCATATATTTCTGGG - Intronic
924498648 1:244614835-244614857 TTTTACATGCATATATTACATGG - Intronic
1064155239 10:12898330-12898352 TCGTACATGCAGCTATTTCAAGG - Exonic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1064921237 10:20521143-20521165 TGTTGCATGCATAGATTGCATGG - Intergenic
1068180285 10:53509538-53509560 TGTTACATGGATATATTGCACGG + Intergenic
1070431699 10:76346552-76346574 AGGTACGTGCATATATTGTATGG + Intronic
1078129675 11:8602877-8602899 TCTTACATGCATTTATTGTGTGG - Intergenic
1080919213 11:36692086-36692108 TCTGACATGGAAATATTGCAGGG - Intergenic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1089070878 11:115698666-115698688 TGTTACATGGGTATATTGCATGG + Intergenic
1091186393 11:133651434-133651456 TTTTACATGGATATATTGCATGG + Intergenic
1093431410 12:19089548-19089570 TTGTAGAGCCATATATTGCATGG + Intergenic
1094169522 12:27478334-27478356 TGGTGCATGCATATGCTGCATGG - Intronic
1095382198 12:41608642-41608664 TGTTACATGGATATATTGCGTGG - Intergenic
1095784988 12:46100422-46100444 TTGTTTATGCATATCTTGCAGGG - Intergenic
1096624533 12:52886047-52886069 TTGTAGAACCATATATTGCATGG + Intergenic
1099231357 12:80029294-80029316 TTGTAGAGCCATATATTGCATGG + Intergenic
1102411806 12:112726409-112726431 TCTTACATGCATATATTATCTGG + Intronic
1105400254 13:20085929-20085951 CCGTACAAGCATATTTTCCAAGG - Exonic
1107186338 13:37525885-37525907 TCCTACATTCAGATATTGCTAGG + Intergenic
1107229665 13:38093200-38093222 TAGTAAATGCCAATATTGCAGGG - Intergenic
1109332468 13:60946501-60946523 TGTTACATGCATCTATTGCATGG + Intergenic
1110568701 13:76981491-76981513 TTGTAGAACCATATATTGCAGGG - Intergenic
1111211617 13:85087096-85087118 TGGTACCTGGGTATATTGCATGG - Intergenic
1113059260 13:106303604-106303626 TGCTATATGCATAGATTGCATGG - Intergenic
1114395672 14:22358189-22358211 TGTTACATGGATGTATTGCATGG + Intergenic
1116361256 14:44001202-44001224 TGGTACAGGTATATAATGCATGG - Intergenic
1121673782 14:95734937-95734959 TGGTCCATGCATATATGGCTGGG - Intergenic
1122005704 14:98701803-98701825 TGTTACATGGATATATTGCATGG + Intergenic
1127673970 15:61222888-61222910 TCTTACATAGATATATTGAAGGG - Intronic
1128363443 15:66979496-66979518 TGTTACAAGCATATATTGCATGG + Intergenic
1129293151 15:74584085-74584107 TTTTACATGGATATACTGCAGGG + Intronic
1131917397 15:97284037-97284059 TGTAACATGGATATATTGCATGG + Intergenic
1132162083 15:99551693-99551715 TCGTAGAACCACATATTGCATGG - Intergenic
1134182507 16:12059160-12059182 TTGTACTTGCATATGTTGCGGGG + Intronic
1135615754 16:23909510-23909532 TATTACATGGGTATATTGCATGG + Intronic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1138788984 16:59879974-59879996 TAGTAGATACATATATAGCATGG - Intergenic
1140599447 16:76457841-76457863 TGTTACATGGGTATATTGCATGG + Intronic
1140627975 16:76817738-76817760 TGTTACATGCATATATTGCCTGG + Intergenic
1147463394 17:40590569-40590591 TAGTAAATGGAAATATTGCAAGG + Intergenic
1149322893 17:55499396-55499418 TCTTACATGGATAAACTGCATGG + Intergenic
1149919208 17:60640582-60640604 TGTTACATGGGTATATTGCATGG + Intronic
1156320891 18:36020860-36020882 TCATACATCCATATATTAAAAGG + Intronic
1159761991 18:72438534-72438556 TGTTACATGCATATATTGCATGG + Intergenic
925946687 2:8870711-8870733 TAGTACAAGTATTTATTGCATGG + Intronic
927170481 2:20365263-20365285 TAGAACATGCATGTACTGCACGG - Intergenic
927323887 2:21780752-21780774 TAATCAATGCATATATTGCATGG - Intergenic
929092373 2:38231971-38231993 TTGTAGAGCCATATATTGCATGG + Intergenic
931264364 2:60647304-60647326 ATGTACATGTGTATATTGCACGG + Intergenic
933644905 2:84803399-84803421 TGTTACACGGATATATTGCATGG - Intronic
934930389 2:98417505-98417527 TGTTACATGCATAGATTGCATGG - Intergenic
935036278 2:99377563-99377585 TCGAACATGGGTATATGGCAAGG - Intronic
935405722 2:102707200-102707222 TGTTACATGGGTATATTGCATGG - Intronic
937831957 2:126434038-126434060 TCGTTCAAGCATGGATTGCAGGG + Intergenic
939472346 2:142639568-142639590 TCTTACATGCATATATTGTGTGG + Intergenic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
941019116 2:160389286-160389308 TATTTCATGCATATTTTGCAGGG - Intronic
942960366 2:181823017-181823039 TGTTACATGCACAGATTGCATGG + Intergenic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
944900561 2:204209909-204209931 TGTTACATGAATAAATTGCATGG - Intergenic
946411882 2:219519484-219519506 ACGTGCATGCATATTTTGGAGGG - Intronic
1169124948 20:3120890-3120912 AGGTACAAGGATATATTGCATGG - Intronic
1169246267 20:4027648-4027670 TGTTACATGGATATATTGCATGG + Intergenic
1171286367 20:23942198-23942220 TCTTACATGCATACATTGTGTGG - Intergenic
1173035974 20:39410744-39410766 TGCTACATGGGTATATTGCATGG - Intergenic
1174873841 20:54207541-54207563 TATTACATGGATATACTGCATGG - Intergenic
1177013334 21:15754368-15754390 TGGTACATACATATAATGCCTGG - Intronic
1177543324 21:22523642-22523664 TGTTACATGGATATATTACATGG - Intergenic
1183065626 22:35360809-35360831 TGTTACATGGATATATTGCCTGG + Intergenic
956622839 3:71238384-71238406 TTGTACATTCATTTATTGAACGG - Intronic
961345812 3:126262727-126262749 GCCTAAATGCATATTTTGCAGGG + Intergenic
961563184 3:127745634-127745656 TGTTACATGGATATATTGCGTGG - Intronic
962090970 3:132243843-132243865 TTGTAGAACCATATATTGCATGG - Intronic
964287439 3:155134180-155134202 TGTTACATGGATATATTGCATGG + Intronic
964523205 3:157589034-157589056 TGTTACATGAATATATTGCATGG - Intronic
971012358 4:22452345-22452367 TGTTACAGGCATAGATTGCATGG - Intronic
971939920 4:33200880-33200902 AAGTAAATGCATATCTTGCATGG - Intergenic
973218654 4:47700476-47700498 TCTTTCAGGCATATTTTGCAGGG + Intronic
973228039 4:47808932-47808954 ATGTACATGACTATATTGCAAGG + Intronic
974518773 4:62953530-62953552 TGTTACATGTATATAATGCACGG - Intergenic
975363819 4:73504663-73504685 TGTTACATGTGTATATTGCATGG + Intergenic
975756897 4:77580194-77580216 TGTTACATGCATAGATTGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975909697 4:79252284-79252306 TGTTACATGGATATATTGCTTGG - Intronic
981269318 4:142826120-142826142 TCATATATGTATATATTTCATGG - Intronic
982958337 4:161801178-161801200 TTGTTCATGCATTTATTGTAAGG + Intronic
986121594 5:4842729-4842751 TCATATATGCATATAGTGCCTGG - Intergenic
986374225 5:7113933-7113955 TGTTACATGGATACATTGCATGG + Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
990969351 5:61486011-61486033 TGTTACATGCATAGATTTCATGG + Intronic
991987014 5:72299209-72299231 TGTTACATGGGTATATTGCATGG - Intronic
993195763 5:84743356-84743378 TAGTACATGCATATATTTATGGG + Intergenic
993322736 5:86494196-86494218 TGTTACATGGATATATTGCATGG + Intergenic
994004880 5:94826273-94826295 TTGTAAAGCCATATATTGCATGG - Intronic
995233321 5:109796363-109796385 TGATACATGTATATATTTCATGG + Intronic
996007334 5:118437583-118437605 TGTTACATGCATATATTGCCTGG - Intergenic
997982039 5:138474018-138474040 TTGTAGACCCATATATTGCATGG + Intergenic
999235978 5:150094705-150094727 TTGTAGAGCCATATATTGCATGG + Intronic
1000137160 5:158364001-158364023 TCGTATACACATATATAGCATGG + Intergenic
1005961932 6:30700176-30700198 TCTTACATGCATGTATTAAATGG - Exonic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009918482 6:70026250-70026272 TGATACATGCATATATTTGAGGG + Intronic
1011338860 6:86290154-86290176 TAGTACCTGCATTTTTTGCAAGG - Intergenic
1012434315 6:99198765-99198787 TGGTACATACATATATACCATGG - Intergenic
1013890711 6:115023289-115023311 TTATACATGCATATATTTTAAGG + Intergenic
1015444092 6:133283717-133283739 TGTTACGTGGATATATTGCATGG + Intronic
1022667174 7:32422377-32422399 TGTTACCTGGATATATTGCATGG + Intergenic
1030264872 7:107609605-107609627 TTGTACATGCCTATATTGTGAGG - Intronic
1030353018 7:108510633-108510655 TTGTAGAGCCATATATTGCATGG + Intronic
1030549371 7:110938682-110938704 TGTTACATGGATATATTGCATGG - Intronic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1037187221 8:16078626-16078648 TGCTACATGGATATATTACATGG + Intergenic
1037255996 8:16954379-16954401 TCTTACATGCACATATTGCCTGG - Intergenic
1042858521 8:73291775-73291797 TTGTAGAGCCATATATTGCATGG - Exonic
1043224892 8:77713701-77713723 TGCTACATGCATATATTGCATGG + Intergenic
1043822672 8:84887881-84887903 TCTTATATGCATATATTTAAGGG + Intronic
1043925071 8:86027599-86027621 TGTTACATGGGTATATTGCATGG + Intronic
1044424504 8:92035441-92035463 TCTTACATGCATATATTGTGTGG - Intronic
1046111529 8:109731647-109731669 TGTTACATGGATATATTGCATGG - Intergenic
1046287733 8:112116616-112116638 TGTTACATGGATATATGGCATGG - Intergenic
1048102020 8:131362644-131362666 TGTTACATGGATATATTGCATGG - Intergenic
1057946693 9:99336542-99336564 TTGTACATGAATATTTTACAAGG + Intergenic
1058665797 9:107314241-107314263 TCTTACATGCATATATTATGTGG + Intronic
1059864813 9:118502502-118502524 TGTTACATGCATATATTGCATGG + Intergenic
1185884030 X:3766103-3766125 TGTTACATGGATATATTGCATGG + Intergenic
1185914162 X:4016890-4016912 TATTACATGCATGGATTGCATGG + Intergenic
1185938134 X:4282160-4282182 TTTTACATGGATATATTGCATGG + Intergenic
1186029722 X:5354609-5354631 TGCTACATGCATATATTGCATGG + Intergenic
1187058231 X:15761232-15761254 TGTTACATGGGTATATTGCATGG + Intronic
1187114885 X:16339350-16339372 TGTTACATGGGTATATTGCATGG + Intergenic
1187832348 X:23395172-23395194 CCCTACATGCATTTTTTGCATGG + Exonic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1190764556 X:53465250-53465272 TCATGCATGCATTTATTCCATGG - Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193113068 X:77749002-77749024 TCGTACATGCATATATTGCATGG + Intronic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1196529352 X:116766190-116766212 TGTTACATGGATATATTGCATGG + Intergenic
1197573867 X:128183381-128183403 ACATACATGCACATATTGTATGG + Intergenic
1198373114 X:136011168-136011190 TATGACATGGATATATTGCATGG - Intronic
1198453430 X:136791437-136791459 TTGTAAAACCATATATTGCATGG + Intergenic
1198527929 X:137521009-137521031 TCCTATTTGCATCTATTGCAAGG - Intergenic
1200781339 Y:7218836-7218858 TGTTACATGGATATATTGCATGG - Intergenic