ID: 1193114847

View in Genome Browser
Species Human (GRCh38)
Location X:77766384-77766406
Sequence CGGGGTGGCAGCGGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4433
Summary {0: 1, 1: 34, 2: 390, 3: 1710, 4: 2298}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193114830_1193114847 26 Left 1193114830 X:77766335-77766357 CCTCCTGGACGGGGTGGCTGCCG 0: 30
1: 603
2: 705
3: 1718
4: 8457
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298
1193114829_1193114847 27 Left 1193114829 X:77766334-77766356 CCCTCCTGGACGGGGTGGCTGCC 0: 41
1: 657
2: 1136
3: 4542
4: 2615
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298
1193114835_1193114847 6 Left 1193114835 X:77766355-77766377 CCGGGCGGAGACGCTCCTCACTT 0: 1099
1: 3760
2: 4462
3: 8074
4: 7819
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298
1193114828_1193114847 30 Left 1193114828 X:77766331-77766353 CCTCCCTCCTGGACGGGGTGGCT 0: 68
1: 1166
2: 4743
3: 2887
4: 1238
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298
1193114833_1193114847 23 Left 1193114833 X:77766338-77766360 CCTGGACGGGGTGGCTGCCGGGC 0: 570
1: 950
2: 2606
3: 3821
4: 9042
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298
1193114840_1193114847 -9 Left 1193114840 X:77766370-77766392 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG 0: 1
1: 34
2: 390
3: 1710
4: 2298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193114847 Original CRISPR CGGGGTGGCAGCGGGGCAGA GGG Intronic
Too many off-targets to display for this crispr