ID: 1193124555

View in Genome Browser
Species Human (GRCh38)
Location X:77857409-77857431
Sequence ACATATGAGTTACAGGTGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193124555_1193124559 -9 Left 1193124555 X:77857409-77857431 CCCCGCACCTGTAACTCATATGT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1193124559 X:77857423-77857445 CTCATATGTATCACCCCGTTTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1193124555_1193124560 -8 Left 1193124555 X:77857409-77857431 CCCCGCACCTGTAACTCATATGT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1193124560 X:77857424-77857446 TCATATGTATCACCCCGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 47
1193124555_1193124567 25 Left 1193124555 X:77857409-77857431 CCCCGCACCTGTAACTCATATGT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1193124567 X:77857457-77857479 GCAGGAAAGTTGATGAAAGTTGG 0: 1
1: 0
2: 1
3: 31
4: 281
1193124555_1193124564 7 Left 1193124555 X:77857409-77857431 CCCCGCACCTGTAACTCATATGT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1193124564 X:77857439-77857461 CGTTTGGGTTTCCCTTTTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193124555 Original CRISPR ACATATGAGTTACAGGTGCG GGG (reversed) Exonic
901392166 1:8953508-8953530 ACATAGGAGGTTGAGGTGCGAGG + Intronic
901602023 1:10430081-10430103 ACACCTGAGGTACAGGTGCATGG + Exonic
902574155 1:17366703-17366725 ACGTATGGGTTGCAGGTGGGAGG + Intergenic
905847552 1:41245084-41245106 ACCTTTGGGTTACAGGTGTGGGG + Intergenic
921761378 1:218919151-218919173 ACATCTGGGTTACAGGTGTGAGG - Intergenic
921799644 1:219387391-219387413 ACACAGCAGTTACAGGTGAGGGG - Intergenic
1067082962 10:43221849-43221871 CCAGATGAGATACAGGTGTGGGG + Intronic
1068265391 10:54642030-54642052 ACATATGAATTATGGGTGGGGGG - Intronic
1069938520 10:71936915-71936937 ACATATGAATTGGAGGTGGGGGG + Intergenic
1073660415 10:105469988-105470010 ACATATGAATTAAAGATGTGTGG + Intergenic
1074453707 10:113579690-113579712 TCAGATGAGTTGCAGGTGAGGGG + Intronic
1075267016 10:121009590-121009612 AGATATGAGTTACAGCTACTGGG + Intergenic
1078521392 11:12066759-12066781 ACAAATGTGTTCCAGGTGCTTGG + Intergenic
1079980099 11:27142025-27142047 ACATATGAGTTTCAGGTACCTGG - Intergenic
1080169109 11:29277436-29277458 ACATATGAATTACAGGGGCAAGG - Intergenic
1089791712 11:120950010-120950032 ACATGTGAGTTACTGGCGCTTGG - Intronic
1091209647 11:133845254-133845276 AAATTTGAGTAACAGTTGCGGGG - Intronic
1104546701 12:129719500-129719522 TCATATGAGTGACAGATGCAGGG + Intronic
1106930091 13:34654041-34654063 ACATTTGGGTTAAAGGTGAGAGG - Intergenic
1107611042 13:42113213-42113235 TGATATTAGTTAAAGGTGCGTGG + Intronic
1108528615 13:51307338-51307360 AGATATGAATTACATGTGCTCGG - Intergenic
1109136746 13:58661311-58661333 AAATAAGAGTCACAGGTGCTGGG + Intergenic
1119131279 14:72175237-72175259 ACATAAGAGTTCCAGGTACATGG - Intronic
1123714982 15:23021212-23021234 ACATATGAGTCTGAGGTGAGAGG - Intronic
1128609729 15:69063984-69064006 AGATATGACTGACAGGGGCGTGG + Intergenic
1129174779 15:73832146-73832168 AAACATGAGTTACATGTGCAGGG - Intergenic
1136384548 16:29915024-29915046 ACATATAAGTCACTGGTGTGTGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142743761 17:1944874-1944896 TCAGATGAGATACAGGGGCGAGG - Intronic
1151080820 17:71326487-71326509 ACAGATGAGTTGCAGGAGAGGGG + Intergenic
1162809520 19:13155614-13155636 ACAAAGGAGTCGCAGGTGCGGGG + Intergenic
1163557895 19:18002628-18002650 ACACAAGAGCCACAGGTGCGGGG + Intronic
1165572233 19:36785122-36785144 ACTTGTGAGTTTCAGGTGGGAGG + Intergenic
925260559 2:2524914-2524936 ACAGAGGAGTTAGAGGTGAGAGG - Intergenic
926938348 2:18109610-18109632 ACATATTAGGTACAGGTGATAGG - Intronic
929544226 2:42845244-42845266 ACACATTAGTTACAGATGCAGGG - Intergenic
931110439 2:59104953-59104975 ACATATGAATTTGAGGTGAGAGG + Intergenic
933454163 2:82500169-82500191 ACTTATGAGGTAGAGGTGGGAGG + Intergenic
935861479 2:107336061-107336083 ACATAAGAGTTATGGGTGTGGGG + Intergenic
937584470 2:123529852-123529874 ACATATGAGTTCCAATTGTGTGG - Intergenic
938199824 2:129363470-129363492 ACATGGGAGGTACAAGTGCGAGG + Intergenic
939168829 2:138670313-138670335 TCATCTGAGCTACAGTTGCGTGG - Intergenic
939623797 2:144451855-144451877 ACATATGCATTACATGTGCCTGG + Intronic
944304614 2:198165229-198165251 TCAGATGAGGTACAGGTGGGAGG + Intronic
1175716731 20:61259909-61259931 ACATCTGAGTTCCAGGTAGGAGG - Intronic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
951284506 3:20792580-20792602 ACACATGAGTTCCAGATGAGAGG + Intergenic
952744650 3:36765061-36765083 AAATATGAGGAACAGGTGTGTGG - Intergenic
956757345 3:72401930-72401952 ACATATGAGTTGTGGGGGCGGGG - Intronic
966257208 3:177930577-177930599 ACATAGGGGTTACAGGTCCATGG - Intergenic
969160909 4:5258224-5258246 ACATCTGAGTTAAACGTGCAGGG + Intronic
982248631 4:153381378-153381400 TCATATGAGATACAGGTTTGTGG + Intronic
983440200 4:167772656-167772678 AAATATGACTTACAGCTGTGGGG - Intergenic
987098654 5:14573057-14573079 ACATATGAATTACGGGAGCGAGG + Intergenic
993508279 5:88738361-88738383 ACATAGCAGTTACAAGTGCCTGG - Intronic
997660853 5:135588545-135588567 TCAAATGAGTTACGGATGCGAGG + Intergenic
1000858197 5:166426227-166426249 ACAAATAAGTTACAGGTGAAAGG + Intergenic
1002126242 5:177046985-177047007 ACATATGGATTACACGTGTGGGG + Intronic
1010972296 6:82275841-82275863 AGATGTGAGTCACAGGTGCCTGG - Intergenic
1022356743 7:29622852-29622874 ACATCTGCGTTACAGGGGCTGGG - Intergenic
1023416744 7:39940514-39940536 ACATATGAGCTAATGGTGCATGG - Intergenic
1025186807 7:56866907-56866929 TAATATTAGTTACAGGTGCCAGG - Intergenic
1025685116 7:63710008-63710030 TAATATTAGTTACAGGTGCCAGG + Intergenic
1034313661 7:150111057-150111079 ACCTGTGAGGTACTGGTGCGAGG - Intergenic
1035274910 7:157742133-157742155 TCACATGAGTTACAGGTGATTGG - Intronic
1035619502 8:1027255-1027277 ACATATTAGTTACACGCCCGTGG + Intergenic
1036774378 8:11600037-11600059 AAATAAGGGTTACAGGTGGGAGG - Intergenic
1048142979 8:131813090-131813112 ATTTATGAGTTACATGTGCATGG + Intergenic
1048226049 8:132586616-132586638 ACATGAGAGTTACAGGTCCCAGG - Intronic
1050297915 9:4225267-4225289 ACATTTGAGTCACAGGTCCTAGG - Intronic
1051882816 9:21857310-21857332 ACATATCATTTACATGTGCCTGG + Intronic
1060373430 9:123097104-123097126 ACATACGAGTTCCTGGTGCTGGG - Intronic
1187776746 X:22768842-22768864 ACATAGGAGTCACGGGTGCGGGG + Intergenic
1193124555 X:77857409-77857431 ACATATGAGTTACAGGTGCGGGG - Exonic
1198408978 X:136346727-136346749 ACATATGAGTAACAGGCACAGGG - Exonic