ID: 1193130074

View in Genome Browser
Species Human (GRCh38)
Location X:77910595-77910617
Sequence CTTCCGGGTGATGCCCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193130074_1193130095 30 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130095 X:77910648-77910670 GCGGCTGGCCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 58
4: 544
1193130074_1193130086 1 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130086 X:77910619-77910641 GGGGGTAGTCGAGGGAGGGAGGG 0: 1
1: 0
2: 3
3: 72
4: 956
1193130074_1193130094 29 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130094 X:77910647-77910669 GGCGGCTGGCCGCCGCGGCGGGG 0: 1
1: 0
2: 3
3: 22
4: 291
1193130074_1193130093 28 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130093 X:77910646-77910668 AGGCGGCTGGCCGCCGCGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 162
1193130074_1193130090 15 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130090 X:77910633-77910655 GAGGGAGGGGTAAAGGCGGCTGG 0: 1
1: 0
2: 2
3: 46
4: 480
1193130074_1193130083 -4 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130083 X:77910614-77910636 GAAGTGGGGGTAGTCGAGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 258
1193130074_1193130080 -8 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130080 X:77910610-77910632 CCCGGAAGTGGGGGTAGTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1193130074_1193130087 2 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130087 X:77910620-77910642 GGGGTAGTCGAGGGAGGGAGGGG 0: 1
1: 0
2: 3
3: 66
4: 749
1193130074_1193130085 0 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130085 X:77910618-77910640 TGGGGGTAGTCGAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 571
1193130074_1193130088 8 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130088 X:77910626-77910648 GTCGAGGGAGGGAGGGGTAAAGG 0: 1
1: 0
2: 2
3: 52
4: 648
1193130074_1193130089 11 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130089 X:77910629-77910651 GAGGGAGGGAGGGGTAAAGGCGG 0: 1
1: 2
2: 78
3: 566
4: 3314
1193130074_1193130084 -3 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130084 X:77910615-77910637 AAGTGGGGGTAGTCGAGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 239
1193130074_1193130082 -7 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130082 X:77910611-77910633 CCGGAAGTGGGGGTAGTCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1193130074_1193130092 27 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130092 X:77910645-77910667 AAGGCGGCTGGCCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 120
1193130074_1193130091 24 Left 1193130074 X:77910595-77910617 CCGGCAGGGGCATCACCCGGAAG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1193130091 X:77910642-77910664 GTAAAGGCGGCTGGCCGCCGCGG 0: 1
1: 0
2: 0
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193130074 Original CRISPR CTTCCGGGTGATGCCCCTGC CGG (reversed) Intergenic
900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG + Intronic
901201447 1:7469601-7469623 CTTCCAGGTGCTGCCCCGACAGG - Intronic
901256013 1:7827366-7827388 CTTCCGGGTGAGGTCGCGGCTGG - Exonic
901577001 1:10209812-10209834 CTTCTGGGAGATGCCCTTGAAGG - Intergenic
903366594 1:22809098-22809120 CTTCCCGGCGGTGCCTCTGCAGG + Intronic
903440965 1:23387554-23387576 ATTCCGGGTCCTGCCCCAGCTGG + Intronic
904612487 1:31733103-31733125 CTGCGTGGTGCTGCCCCTGCTGG - Exonic
906078440 1:43068540-43068562 CTTCCGGCTGACAGCCCTGCCGG + Intergenic
910743330 1:90546038-90546060 CTTCCAGGTCATGCCCTTGATGG + Intergenic
911092561 1:94029502-94029524 CTCCCTGGTGCTGCACCTGCAGG + Exonic
913358569 1:117952521-117952543 TTTCCTGGTGATGACCCTGGAGG - Exonic
915244073 1:154543969-154543991 CTTCCTGGTGCTGCTCCTGAGGG + Exonic
919151157 1:193700688-193700710 GGTCCGAGTGATGCCACTGCTGG - Intergenic
920095348 1:203483162-203483184 GATCCAGGTGATGCACCTGCAGG - Exonic
920191181 1:204194902-204194924 CTCCAGGATGAAGCCCCTGCAGG - Intronic
923198725 1:231691832-231691854 GTTCCGACTGCTGCCCCTGCCGG + Intronic
924483381 1:244456330-244456352 CTTCAGGGTGGAGCCCCTGGAGG - Intronic
1066434779 10:35387355-35387377 CTTCAGGGTTCTGCCCCTTCTGG + Intronic
1066480911 10:35794827-35794849 CTTCTGGTTGGTGCCGCTGCAGG + Intergenic
1067731353 10:48813986-48814008 CTTCCTGGTGGTGCCTCTGCAGG - Exonic
1074469151 10:113711450-113711472 CTTCCAGGAAATGCCCCAGCAGG - Intronic
1077500612 11:2908289-2908311 CTTCGGGGTGCTGCAGCTGCTGG + Exonic
1078098278 11:8313573-8313595 CTTCCGTGTGGTGCTTCTGCAGG - Intergenic
1079235479 11:18685815-18685837 CTTCAGGGTGAGGCCCGTGGAGG - Intergenic
1079301998 11:19286373-19286395 CTCCAGGGGGATGCCCCTCCGGG + Intergenic
1080751806 11:35157726-35157748 CCTTGGGGTGATGCCCTTGCAGG - Intronic
1080777025 11:35395482-35395504 CTTCCGGGTGCTGGCTATGCTGG - Intronic
1081775220 11:45671692-45671714 CTTCCAGGTGGTTCCCCTGCAGG + Intergenic
1081780327 11:45706189-45706211 CTGCCTGGTGGTGTCCCTGCAGG + Intergenic
1082756467 11:57081493-57081515 CTTCCTGGTGATGCTCATGCTGG - Intergenic
1083193434 11:61068755-61068777 CTTCCGGGTGTTCTCCCTGCTGG + Intergenic
1083635111 11:64116651-64116673 CCTCCGGGAGCTGCACCTGCAGG + Exonic
1084013293 11:66364391-66364413 CAGCCGGCTGCTGCCCCTGCTGG - Exonic
1084751662 11:71208203-71208225 CTTCCAGCTCATGCCCCTCCAGG - Intronic
1085537478 11:77231880-77231902 CTTCCTGGAGATGACCCTGAAGG - Intronic
1086686206 11:89735739-89735761 CTTCAGGCTGTTGCCCCTGTGGG - Intergenic
1086700331 11:89894590-89894612 CTTCAGGCTGTTGCCCCTGTTGG + Intergenic
1086705839 11:89949936-89949958 CTTCAGGCTGTTGCCCCTGTTGG - Intergenic
1089276952 11:117343575-117343597 CTTCCCTCTGAGGCCCCTGCTGG + Intronic
1089494999 11:118903314-118903336 CTTCGGCCTGATGCCCCTGGGGG - Exonic
1091181954 11:133613278-133613300 TTTCCAGGTGATGCTCATGCTGG - Intergenic
1091754081 12:3040544-3040566 CTTCAGGGGGCTGCCCCTGCAGG - Exonic
1094161256 12:27393336-27393358 CTTCCAGGTGATTCCAATGCAGG - Intronic
1096244247 12:49975467-49975489 CTTCTGGGTGGGGCCCCTGATGG + Exonic
1102517045 12:113456693-113456715 CTCCCAGGTGATGCCACTGCTGG + Intergenic
1104153446 12:126107317-126107339 CTTCTGGGTGAAGCTGCTGCTGG + Intergenic
1104371973 12:128231438-128231460 CTTTAGGGTGATGACCCTGTAGG + Intergenic
1106699732 13:32216493-32216515 CTTCCGGGTGCAGGCCCTCCAGG + Intronic
1113885389 13:113656180-113656202 CTCCCTGGTGCTGGCCCTGCAGG + Intronic
1118459748 14:65977129-65977151 CTGATAGGTGATGCCCCTGCAGG + Intronic
1119851170 14:77867665-77867687 CTTCCTGCTGATGCCCCATCTGG + Intronic
1119910048 14:78341345-78341367 CTCCCAGGTGATGCCCATGCTGG + Intronic
1120494861 14:85222456-85222478 CTCACGGGTGATGCTCCTTCAGG - Intergenic
1120789127 14:88563163-88563185 GATCCGGGTGAGGCCCGTGCCGG + Exonic
1128700584 15:69801332-69801354 GCTCCGGGTGATGCCCAGGCGGG + Intergenic
1129110363 15:73333604-73333626 CTTCAGGGTCATGCCCTTGATGG - Intronic
1132850089 16:2020962-2020984 CTTCTGGGTCATGCCCCGGGAGG + Intergenic
1138609298 16:58110268-58110290 CTTCTGGGTGAAGCCACTGAGGG + Intergenic
1139552559 16:67683196-67683218 CTCCCAGGTGATGCTGCTGCTGG + Intronic
1140127844 16:72132732-72132754 CTGGCTGGTGAGGCCCCTGCAGG - Exonic
1142276026 16:89119299-89119321 CTTCCTGGTGATGCCTCTACTGG - Intronic
1142593980 17:1020776-1020798 CATCCTGGGGATGCCCCTGAGGG + Intronic
1146778158 17:35640716-35640738 GTTCAGGGTGATGCTGCTGCTGG + Intronic
1148795113 17:50193167-50193189 CCCCCGGGGAATGCCCCTGCAGG + Intronic
1150764539 17:67993170-67993192 CATCCGGCTGGTGACCCTGCTGG - Exonic
1151660869 17:75517199-75517221 CTTCCGGGTGAAGGCGCTGCCGG - Exonic
1152122452 17:78427093-78427115 CTTCCAGGTGAAGGCCGTGCTGG - Exonic
1152314980 17:79574954-79574976 CTCCTGCGTGATGCCGCTGCTGG + Intergenic
1154280826 18:13001506-13001528 CTTCCGGGAGATGACCCGGATGG - Exonic
1156167011 18:34434002-34434024 CTACATGGTGATTCCCCTGCTGG - Intergenic
1160699165 19:497840-497862 CCTCCAGGTGAAGCCCCTGCAGG + Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1163110905 19:15160691-15160713 CTTCCGGCTGGGGCCCCAGCTGG + Exonic
1163806896 19:19405276-19405298 CTTCCGCGTGACGACCCCGCGGG + Intronic
1166676622 19:44745296-44745318 CATCCAGGGGCTGCCCCTGCGGG + Intergenic
1166785466 19:45364365-45364387 CCTCTGAGTGAGGCCCCTGCAGG - Intronic
1166862003 19:45816331-45816353 CTCCCAGGGGATGCTCCTGCTGG - Intronic
1166979381 19:46623757-46623779 CTTCTGCGCGCTGCCCCTGCTGG - Exonic
1167851976 19:52209077-52209099 CCTCCGGGTGATTCTGCTGCAGG + Intronic
927805593 2:26143883-26143905 CTCCCAGGTGATTCCCATGCAGG - Intergenic
931458614 2:62431887-62431909 CTTGAGGGTGAGGCCCTTGCTGG - Intergenic
934580975 2:95437719-95437741 CTTCAGGCTGTTGCCCCTGTTGG - Intergenic
934598475 2:95638995-95639017 CTTCAGGCTGTTGCCCCTGTTGG + Intergenic
935794887 2:106631506-106631528 GTTCCAGCTGAAGCCCCTGCAGG - Intergenic
936339535 2:111618725-111618747 CTTCCAGGAGAAGCTCCTGCTGG + Intergenic
939500217 2:142975046-142975068 CTTGAGGGTGAGGCCTCTGCTGG - Intronic
947363610 2:229371421-229371443 ATTCCTGGTCATGCACCTGCTGG - Intronic
947621726 2:231595107-231595129 CTGGTGAGTGATGCCCCTGCTGG + Intergenic
948127359 2:235574098-235574120 CTTTTAGGTGATGTCCCTGCAGG - Intronic
948305031 2:236940329-236940351 ATTCCTGCTGATGGCCCTGCAGG + Intergenic
1169434714 20:5575935-5575957 GTTCAGGGTGATGCCCTTCCTGG - Exonic
1173518500 20:43682211-43682233 CTTCATGGTGAGGCCCCTGCAGG + Intronic
1173704721 20:45101203-45101225 ACTCCGGAGGATGCCCCTGCAGG - Intergenic
1174197346 20:48782835-48782857 CTCCCTTGTGATGCCCCTCCTGG - Intronic
1176234644 20:64048711-64048733 CTTCCGCGAGCTGCCCCCGCTGG - Exonic
1179053156 21:37906579-37906601 CTCCCTGGTGATGCTGCTGCTGG + Intronic
1184192124 22:42901855-42901877 CGCCCTGGTGGTGCCCCTGCAGG - Intronic
1184410835 22:44325408-44325430 GGTCCCGGTGATGCCCATGCTGG - Intergenic
951796068 3:26539826-26539848 CTCCCAGGTGATGATCCTGCTGG - Intergenic
953790873 3:45946943-45946965 CATCTGGGTGATATCCCTGCTGG + Exonic
954870233 3:53762152-53762174 TGTCCAGGTGATGCCACTGCAGG - Intronic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
966212847 3:177470745-177470767 ATTCTCGGTGATGCCCCTACAGG + Intergenic
968519479 4:1029154-1029176 CTTCTGGGCAATGCCCTTGCAGG + Intergenic
970202189 4:13621152-13621174 CTTCCAGGCAATGCCCCTTCAGG - Intronic
973238878 4:47935546-47935568 CTCCCAGGTGATGCTCATGCTGG + Intronic
979441521 4:120755805-120755827 CTTCCGTATGATGTCTCTGCTGG - Intronic
982032253 4:151312575-151312597 GGTCCTGGTGATGCCACTGCTGG - Intronic
983238671 4:165207582-165207604 CTTCCGGGTTCGGCCCCGGCCGG - Intronic
984874501 4:184355190-184355212 CTTCGCTGTGTTGCCCCTGCAGG - Intergenic
986826301 5:11526493-11526515 CTTCCAGGTGCTGGCCCAGCTGG + Intronic
987546948 5:19322861-19322883 CTTCTGGGTGGTGACCTTGCTGG + Intergenic
996580702 5:125029259-125029281 GCTCCGGGTTTTGCCCCTGCTGG + Intergenic
999837649 5:155391845-155391867 CATCCAGGTGATGCCAGTGCAGG - Intergenic
999953010 5:156670468-156670490 CCTCAGTGGGATGCCCCTGCTGG + Intronic
1002662437 5:180800786-180800808 CTTACGGGTGAGGCCCTTGAGGG + Intronic
1004814124 6:19294081-19294103 CTTCTGGGTGATACTACTGCTGG - Intergenic
1005712371 6:28514609-28514631 CTTCCGGTTGATACTCATGCAGG - Intronic
1006425400 6:33960041-33960063 CCTGCTGGTGATGCCCCTGCAGG + Intergenic
1016804699 6:148201411-148201433 CTTCCAGGAGATTCCACTGCAGG - Intergenic
1018199571 6:161382577-161382599 CTTCCGCGTATTGCCCCTGGAGG - Intronic
1018947290 6:168356684-168356706 CTGCCTGGGGCTGCCCCTGCTGG - Intergenic
1019351579 7:556568-556590 CTCACGGGTGGGGCCCCTGCCGG - Intronic
1019864639 7:3695825-3695847 CTTCCAGGTGATTACACTGCTGG - Intronic
1023225511 7:37964921-37964943 CTTCCAGGTGATGCTGATGCTGG + Intronic
1024675940 7:51638053-51638075 CCTCCAGGCGATGCCCATGCAGG - Intergenic
1026890266 7:73977597-73977619 CTCTCGGGGGAGGCCCCTGCCGG - Intergenic
1029107997 7:98194029-98194051 CTTCCGTGGGATGCACCTGCTGG - Exonic
1030127596 7:106169200-106169222 TTTCCAGCTGATGCTCCTGCCGG - Intergenic
1035582079 8:746833-746855 CATCCCGGTGTAGCCCCTGCTGG + Intergenic
1038267793 8:26049660-26049682 CTTTCACGTGAAGCCCCTGCTGG + Intergenic
1040560966 8:48523307-48523329 CTTCCCCGTGGTGGCCCTGCAGG + Intergenic
1045281915 8:100756834-100756856 CTCCCAGGTGATGCAGCTGCTGG - Intergenic
1047335863 8:123935600-123935622 CTTCTGGGTGCAGACCCTGCTGG + Intronic
1049770107 8:144375998-144376020 CTTCTGGGAGATGCAGCTGCAGG + Intronic
1050330377 9:4539957-4539979 CTTCAGAGTGAGGCCCTTGCTGG - Intronic
1051079465 9:13278876-13278898 CGTCCGGGAGCGGCCCCTGCAGG + Intronic
1051894703 9:21975102-21975124 CTTCCGGCTGGTGCCCCCGGGGG - Intronic
1053351461 9:37416112-37416134 TTCCCGGGTGATGCTGCTGCTGG - Intergenic
1056268166 9:84920505-84920527 CTTCCGTCTGTTGCACCTGCTGG + Intronic
1059337157 9:113576249-113576271 CTCCTGGGTGATGCTGCTGCTGG + Intronic
1059690268 9:116677853-116677875 CTTCAGGGTGAAGCCCTTGGAGG - Intronic
1061201942 9:129143113-129143135 CTTCCTGGAGCTCCCCCTGCTGG + Intronic
1061552766 9:131347587-131347609 CTTCCCGGTGATGGCCCCTCTGG + Intergenic
1061849034 9:133403806-133403828 CTTCTGGCTGCTGTCCCTGCTGG + Exonic
1062218190 9:135400291-135400313 CTGCTGGGTGATGTTCCTGCAGG - Intergenic
1062306230 9:135908194-135908216 CTTCCGGGGGATGCGCCGGCGGG - Intergenic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1195847612 X:109245099-109245121 CTTCCGGGTTTTGCCCATTCAGG + Intergenic
1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG + Intronic
1197324831 X:125080101-125080123 CTTCCAGGTGATGCTGATGCTGG - Intergenic
1198026001 X:132707822-132707844 CTCCCAGATGATGCCCCTGCAGG - Intronic
1202061085 Y:20889025-20889047 CTTCCAGGTTTTGCCCATGCAGG - Intergenic