ID: 1193132600

View in Genome Browser
Species Human (GRCh38)
Location X:77933032-77933054
Sequence GAGCAGTACTTGCACAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193132600_1193132602 7 Left 1193132600 X:77933032-77933054 CCTACTCTGTGCAAGTACTGCTC 0: 1
1: 0
2: 4
3: 17
4: 175
Right 1193132602 X:77933062-77933084 TGGAATGACAGCAGTGAACCAGG 0: 1
1: 0
2: 1
3: 23
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193132600 Original CRISPR GAGCAGTACTTGCACAGAGT AGG (reversed) Intronic
900743971 1:4348022-4348044 GAGCTGTGCCTGCACAAAGTAGG + Intergenic
900916701 1:5644593-5644615 GAGCAGAATTAGCTCAGAGTGGG + Intergenic
902409415 1:16204398-16204420 TAGCATGCCTTGCACAGAGTAGG + Intronic
903259904 1:22125933-22125955 GAGCAGGACCTGCACATAATAGG - Intronic
904100443 1:28022082-28022104 GAGCAGTGCTTGCACATAGTAGG - Intronic
904422158 1:30401097-30401119 GTGCAGTACTGGCACATTGTAGG + Intergenic
905669216 1:39780163-39780185 GACCAGCACTGGCACAGTGTTGG + Intronic
905959654 1:42033026-42033048 GAGCAGAACGAGCACTGAGTGGG + Intronic
906632539 1:47384256-47384278 GACCAGTGCCTGCACATAGTAGG + Intergenic
908694246 1:66819540-66819562 GCGCAGTACTAGCACATAATGGG - Intronic
909489909 1:76214655-76214677 TTGCAGTTCTTGCACACAGTAGG + Intronic
915632587 1:157163716-157163738 GAGCGGTGCTGGCACAGAGTAGG + Intergenic
918644725 1:186890404-186890426 GATCAATACTTGCACAGTTTGGG + Intronic
920743051 1:208599463-208599485 GTGGAGTAATTGCACAGAGATGG + Intergenic
920747198 1:208640125-208640147 GAGCAGTGTTGGCACAGGGTAGG + Intergenic
921897790 1:220418906-220418928 GAGTATTACATACACAGAGTTGG + Intergenic
922157970 1:223054638-223054660 GTGCAGTTGCTGCACAGAGTAGG - Intergenic
924214895 1:241810895-241810917 GAACAGTGCCTGCATAGAGTAGG + Intergenic
924392291 1:243575810-243575832 GGACAGTACCTGCACATAGTAGG + Intronic
924899861 1:248386100-248386122 TAGCAGTAAGTGCACAGAGCCGG - Intergenic
1067722802 10:48742393-48742415 AAGCCGTGCTTGCACAGAGAGGG + Intronic
1068331315 10:55574411-55574433 GAGCCTTCCTTTCACAGAGTAGG + Intronic
1069941883 10:71962235-71962257 GAGCAGTACTGGCAGAGGGAAGG + Intergenic
1072479180 10:95794349-95794371 CAGCAGTGTCTGCACAGAGTAGG - Intronic
1072603413 10:96954904-96954926 GAGCAGGACTTGCACAGGTAGGG - Intronic
1072619397 10:97069520-97069542 GAGCAGTACTGCCAAAGAGATGG + Intronic
1073240279 10:102053367-102053389 GAACAGTACTTGCAAAGGCTTGG - Intronic
1073682661 10:105721053-105721075 GAACAGTACCTGGACAGAATAGG - Intergenic
1075670698 10:124262447-124262469 GAGCAGTGCCTGGACACAGTAGG + Intergenic
1075734559 10:124655939-124655961 GAGCAGTATGTGCACACAGCAGG + Intronic
1075816681 10:125270103-125270125 AAGCAGCACTTGCACAGAGCAGG - Intergenic
1077456352 11:2683592-2683614 GAGCAGTATTTGAAATGAGTTGG - Intronic
1078147745 11:8733433-8733455 GAACAGGCCTAGCACAGAGTAGG - Intronic
1081819319 11:45976406-45976428 GAACAGTGCTTGCACACAGTAGG + Intronic
1084709219 11:70833668-70833690 GTGCAGTACTTACGCACAGTGGG + Intronic
1092039743 12:5373650-5373672 GAACAGTGCTGGCACAGAGTTGG - Intergenic
1093185178 12:16012112-16012134 GAAAAGTACTAGCATAGAGTGGG + Intronic
1093202547 12:16207177-16207199 TAGCAGTGCTTGCACATAGTAGG + Intronic
1094713111 12:32985426-32985448 GAGAAGTCCTTGAACAGAGTGGG + Intergenic
1095719893 12:45388837-45388859 GCACAGTACCTGAACAGAGTTGG - Intronic
1096613762 12:52820040-52820062 CAGCAGTTCTGGCACACAGTTGG + Intergenic
1099671318 12:85697161-85697183 CAGCAGCACTTGCGCAGAGATGG - Intergenic
1099791703 12:87343541-87343563 GAGAATCACTTGCACAGAGGAGG - Intergenic
1100909489 12:99342049-99342071 GAAGAGTACTGGCACATAGTAGG - Intronic
1102251854 12:111392940-111392962 GAGAAGTCCTAGCACATAGTAGG + Intergenic
1102456465 12:113073809-113073831 GCACAGTACCTGCACACAGTAGG - Intronic
1103036683 12:117662548-117662570 GAGCAGGAGTTGCTTAGAGTAGG + Intronic
1105023440 12:132833324-132833346 GAATAGTACTTGCAGACAGTAGG - Intronic
1105614844 13:22002327-22002349 GAGCAATTCTAGCACAGAGTAGG + Intergenic
1107742267 13:43463914-43463936 GCACAGTACCTGCACATAGTAGG - Intronic
1107994650 13:45848263-45848285 GAGGACCACTTGCACAGATTAGG - Intronic
1113455764 13:110447702-110447724 GAACAGGACAGGCACAGAGTTGG + Intronic
1113728084 13:112620010-112620032 CAAAAGTACTTCCACAGAGTGGG - Intergenic
1113819488 13:113203124-113203146 GAGCAGCACTGGCACAGAGCAGG + Intronic
1115384192 14:32776567-32776589 GGGAAATACTTGCACATAGTAGG + Intronic
1116372542 14:44154559-44154581 GAGCAAGACTTGCACTTAGTTGG - Intergenic
1116808249 14:49514148-49514170 GGGCAATACTGGAACAGAGTAGG - Intergenic
1117375646 14:55116092-55116114 GCACAGTGCTTGCACAGAGCAGG + Intergenic
1117472300 14:56058066-56058088 AAGCAGTTTTTGCCCAGAGTTGG - Intergenic
1122595250 14:102885881-102885903 GAGCAGCTCTGGCACAGAGGAGG + Intronic
1126960061 15:53982398-53982420 GAGCAGTGATTGGACAGAGTGGG + Intergenic
1129668381 15:77592493-77592515 GAGCAGAACCTGTGCAGAGTAGG - Intergenic
1131903841 15:97118771-97118793 CAGCAGTATTCTCACAGAGTGGG + Intergenic
1132105774 15:99061622-99061644 GGGCAGTGCCTGCACACAGTAGG + Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134868247 16:17628431-17628453 GCATAGTACTTGCACATAGTAGG + Intergenic
1135519195 16:23160667-23160689 GAGAGGTACTTGCAAAGATTTGG + Intergenic
1137625641 16:49906429-49906451 GAGCATTAATTGGACAGACTGGG - Intergenic
1139850662 16:69950224-69950246 CAGCAGAGCTTCCACAGAGTTGG + Intergenic
1141123439 16:81381704-81381726 TCTCAGTGCTTGCACAGAGTAGG + Exonic
1143805632 17:9424080-9424102 GAGCAGTTCTTTCACAGCCTGGG - Intronic
1144995845 17:19267882-19267904 GGACAGTGCTTGCACATAGTGGG + Intronic
1146256825 17:31396479-31396501 GTCCAGTATCTGCACAGAGTAGG + Intronic
1149286729 17:55173342-55173364 GAGCAGTAATTGCCAGGAGTTGG - Intergenic
1151140750 17:71989950-71989972 GAGCAGTGCTGGCACGTAGTGGG + Intergenic
1151683096 17:75631925-75631947 GAGGAGTAACTGGACAGAGTGGG - Intronic
1152185023 17:78850490-78850512 GGGCAGTAACTGCACACAGTAGG + Intergenic
1153924585 18:9824917-9824939 GTCCTGGACTTGCACAGAGTAGG + Intronic
1153985056 18:10344035-10344057 GTGCAGTTCCTGCAGAGAGTGGG - Intergenic
1154240709 18:12651123-12651145 GAACACTACTTGTACATAGTAGG + Intronic
1159683064 18:71379441-71379463 GAGAATCACTTGAACAGAGTAGG + Intergenic
1162198229 19:9002172-9002194 GAACAGTGCCTGCACACAGTAGG + Intergenic
1163935366 19:20437529-20437551 CAACAGTCCTTGCACAGACTAGG - Intergenic
1165728825 19:38131129-38131151 GAACAGAGCTTGCACACAGTAGG - Intronic
1167115448 19:47486912-47486934 GGGCAGTAATTGCACAGAGGAGG - Intergenic
1167740853 19:51324170-51324192 GATCAATGCTTACACAGAGTAGG - Intronic
1168415187 19:56163214-56163236 TAGCAGTCCTTCCTCAGAGTGGG + Intergenic
925607884 2:5677361-5677383 TAGCAGTAATTGCAAAGTGTGGG - Intergenic
926304681 2:11629296-11629318 GAGCAGCACGTGCACAGATGTGG + Intronic
929110221 2:38400076-38400098 GCACAGTATTGGCACAGAGTAGG - Intergenic
929278440 2:40050847-40050869 GAGCCCTACTTCCAAAGAGTTGG - Intergenic
930843847 2:55879908-55879930 GAGAAGTACTGGCACAGGGGAGG + Intronic
931272412 2:60714699-60714721 GAACAGTGTTTGCACATAGTAGG + Intergenic
931443644 2:62308688-62308710 GAGCAGGAAAGGCACAGAGTAGG - Intergenic
931680898 2:64749334-64749356 GAGAAATAGTTGCTCAGAGTTGG - Intronic
932144963 2:69308422-69308444 GCTCAGTTCTTGCACTGAGTGGG - Intergenic
932882394 2:75515909-75515931 GAGCAGGATTTACTCAGAGTTGG + Intronic
935066715 2:99655109-99655131 GTCCAGTGCTTGCACATAGTAGG - Intronic
935341501 2:102063524-102063546 GAACTGTGCTTGCACACAGTAGG + Intergenic
936547866 2:113407976-113407998 AAGCAGTAGGTGCTCAGAGTGGG + Intergenic
937259283 2:120575145-120575167 GCGCAGTGCTTGCACATAGTGGG + Intergenic
937347284 2:121133810-121133832 GAGCAGAGCCTGCACATAGTAGG + Intergenic
941474768 2:165937259-165937281 GAGCAGTGGTTGCAAGGAGTTGG + Intronic
941699391 2:168587892-168587914 GAGCAGTACTTGCCCAGAGCAGG - Intronic
942086937 2:172452487-172452509 GGGCAGCATTTGCACAGTGTGGG + Intronic
943687055 2:190829736-190829758 GAGCAGGCCTGTCACAGAGTAGG + Intergenic
944131928 2:196356159-196356181 GAACAGCACTGGCACATAGTAGG - Intronic
944668511 2:201976144-201976166 GAACAGTCCTAGCACATAGTAGG - Intergenic
948363630 2:237439913-237439935 GAGCAATGATTCCACAGAGTGGG - Intergenic
1168970628 20:1928452-1928474 GAGCAGGGCTGGCACATAGTAGG - Intronic
1169807004 20:9569715-9569737 GAGCAATAACTGCACACAGTGGG + Intronic
1170484761 20:16805161-16805183 GAGTAGTACTTGCATATAGATGG + Intergenic
1170831148 20:19841717-19841739 CAGCAGGACCTGCACAGAGTAGG - Intergenic
1175566447 20:59982732-59982754 GAACAGTACTGGCACAGATTAGG - Intronic
1178471603 21:32898569-32898591 CAGCAGTTCTTTCACACAGTAGG + Intergenic
1183768143 22:39898385-39898407 GAACAGGACTAACACAGAGTAGG + Intergenic
1185200302 22:49498586-49498608 GAAGGGTACTGGCACAGAGTGGG - Intronic
952228909 3:31408816-31408838 GAATAGTCCTTGCACACAGTGGG - Intergenic
953071878 3:39528824-39528846 CAGCAGCAGCTGCACAGAGTAGG + Intronic
955224759 3:57051588-57051610 GAGCAGTACCTGCACATATGAGG - Intronic
955954543 3:64275241-64275263 GATCAGTAGTTGCCAAGAGTTGG + Intronic
958892963 3:99800839-99800861 GAGCAGAACCTGCACAGAGCAGG + Intergenic
961325894 3:126109176-126109198 GACCGGGCCTTGCACAGAGTTGG - Intronic
961474870 3:127140314-127140336 GGGCAGCAGGTGCACAGAGTGGG + Intergenic
962149825 3:132881033-132881055 GAACAGTACTGACACACAGTAGG + Intergenic
964395177 3:156237945-156237967 GAACAGTGCTAGCCCAGAGTAGG + Intronic
964650890 3:159009888-159009910 GAACAGTACCAGCACATAGTAGG + Intronic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
966467462 3:180246771-180246793 GAGAAGTACTAGAACAGAATAGG - Intergenic
966588528 3:181653706-181653728 ACACAGTACTTGCAAAGAGTAGG + Intergenic
966805736 3:183805987-183806009 GCACAGTACTTGCACATACTAGG + Intronic
967813158 3:193777353-193777375 GAAAAGTAGTTGCACAGACTGGG - Intergenic
968264504 3:197352338-197352360 GCTCAGTACTGGCACACAGTAGG + Intergenic
968673333 4:1864000-1864022 GAGCAGAGCTTCCACTGAGTTGG - Intergenic
971378254 4:26072960-26072982 GAGCAGTGCTGGCACAGAGTAGG - Intergenic
971499700 4:27305413-27305435 CAGCAGTACTTGGTCAGAGGAGG + Intergenic
972973681 4:44607570-44607592 GAGCAGCACTTGCTGAAAGTAGG - Intergenic
973738849 4:53900410-53900432 GACCAGTGGTGGCACAGAGTAGG + Intronic
977007555 4:91589866-91589888 GAGAATTACTGACACAGAGTGGG + Intronic
977073407 4:92422171-92422193 GATCAGTACTGGCAGAGGGTAGG + Intronic
978509592 4:109501826-109501848 GAATAGTACTGCCACAGAGTAGG - Intronic
979199153 4:117956101-117956123 GAGCAGTAGTTTCATAGAGGAGG - Intergenic
982578055 4:157142553-157142575 CAGCAGTACTTGCACAGAATAGG - Intronic
983246622 4:165295045-165295067 AAGCAGTAGCTGCACAGAGAGGG - Intronic
984481673 4:180311568-180311590 TAGTACTATTTGCACAGAGTAGG - Intergenic
987815559 5:22896863-22896885 TAGCAGTATTTGTACAGATTTGG - Intergenic
989078504 5:37590296-37590318 GATCAGTACTTGCACAGGGCTGG - Intronic
992927315 5:81602058-81602080 GAGAGGTACTTTCACTGAGTAGG - Intronic
993489469 5:88528635-88528657 GATCAGTAGTTGCCTAGAGTTGG - Intergenic
995141382 5:108739210-108739232 GAGAAGTACTTGCACCCAGGAGG + Intergenic
997985782 5:138500548-138500570 GATCAGTAGTTGCCCAGGGTTGG + Intergenic
998530766 5:142882430-142882452 GAACAGTGCTGGCACAGAGCAGG - Intronic
998898262 5:146823528-146823550 GAGCAGAACGTGCACTGAGATGG + Intronic
999103701 5:149049903-149049925 GAGCAGTACTTGCTGGTAGTGGG - Intronic
999460382 5:151752542-151752564 GAACAGTGCCTGGACAGAGTAGG + Intronic
1000293675 5:159894186-159894208 GACCAGAACTGGCACATAGTAGG - Intergenic
1004330632 6:14717380-14717402 CAGCAGAGTTTGCACAGAGTAGG - Intergenic
1004644267 6:17544186-17544208 GCACAGTACCTGCACATAGTAGG + Intronic
1006829014 6:36957803-36957825 GCGCAGTGCTGGCACATAGTAGG - Intronic
1007634795 6:43292886-43292908 GAGCAGCACGGGCAAAGAGTGGG + Intergenic
1010035085 6:71316180-71316202 GAGCAGTAGTTGTAATGAGTGGG - Intergenic
1011629259 6:89308852-89308874 GGGCAGTGTCTGCACAGAGTAGG - Intronic
1012230437 6:96754606-96754628 GAGCAGAACTGGCACAGAATAGG + Intergenic
1014477891 6:121896907-121896929 GAGTATTCCTTGCTCAGAGTTGG - Intergenic
1015183822 6:130390953-130390975 GAGCACTACTAGCACACAGTAGG - Intronic
1015669551 6:135673010-135673032 GAGCAAAACTGGCAGAGAGTAGG + Intergenic
1015733711 6:136375201-136375223 GACTAGTACCTGCACATAGTAGG - Intronic
1017322397 6:153108981-153109003 GAACAGTGCTAGCACATAGTGGG + Intronic
1018655770 6:166034206-166034228 GAGCAGAACTTGGAAAGAGGAGG + Intergenic
1021691726 7:23236715-23236737 GAGCAGGACAGGCAAAGAGTGGG - Intronic
1022476933 7:30717141-30717163 CAGCAGTGCCTGCGCAGAGTAGG - Intronic
1024396743 7:48877855-48877877 AAGCAGTACGTGAACAGAGATGG + Intergenic
1024525438 7:50344880-50344902 GAGCAGTGCTTACACAGATGAGG + Intronic
1025871419 7:65437947-65437969 GAGCTGAACATGAACAGAGTAGG - Intergenic
1026241408 7:68578681-68578703 GACCAATACTTGCACAAAATAGG + Intergenic
1026323388 7:69287023-69287045 GAACAGAACTTCCCCAGAGTGGG - Intergenic
1026932700 7:74232988-74233010 GAGGATCACTTGCCCAGAGTTGG + Intronic
1027543854 7:79501970-79501992 GAGCAGATATTTCACAGAGTGGG - Intergenic
1036979102 8:13448781-13448803 GAACAGTTTTTGCACAGATTAGG + Intronic
1042392194 8:68248812-68248834 GAACAGTGCTGGCACATAGTAGG - Intergenic
1042432338 8:68722747-68722769 GAGGAGTACCTACACACAGTAGG + Intronic
1047237240 8:123052527-123052549 GAGCAGCTCTTGCGCACAGTAGG + Intronic
1050438150 9:5630264-5630286 TAGCAGTGTTTGCAGAGAGTAGG - Intronic
1057413947 9:94845001-94845023 GAATAGTGCTTGCACATAGTAGG - Intronic
1057705596 9:97392842-97392864 GAAAAGTACCTGCACAAAGTAGG + Intergenic
1058530452 9:105900829-105900851 GAACAATGCCTGCACAGAGTAGG + Intergenic
1059639649 9:116204295-116204317 GACTAATACATGCACAGAGTTGG + Intronic
1060268319 9:122125109-122125131 GAGCAGAACTTGCTCACAGAAGG - Intergenic
1060522689 9:124302687-124302709 GAGCAGCATTTGCACTGACTTGG - Intronic
1061150272 9:128824187-128824209 GAGCAGGACCTGCACTGAGCTGG - Intronic
1188472524 X:30556534-30556556 AAACATTACTTGCACACAGTAGG - Intergenic
1191100923 X:56727653-56727675 GAGTAGTACTGGCATATAGTTGG + Intergenic
1193132600 X:77933032-77933054 GAGCAGTACTTGCACAGAGTAGG - Intronic
1195877635 X:109558463-109558485 AGGCAGTACTGGCACATAGTAGG + Intergenic
1196940105 X:120767093-120767115 CAACAGTACTGGCACACAGTAGG - Intergenic
1198426808 X:136528908-136528930 AAGCATTACTTCCACAGAGAGGG + Intergenic
1198514145 X:137387591-137387613 GAGTAGTAGTTGAACAGATTTGG + Intergenic