ID: 1193132600

View in Genome Browser
Species Human (GRCh38)
Location X:77933032-77933054
Sequence GAGCAGTACTTGCACAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193132600_1193132602 7 Left 1193132600 X:77933032-77933054 CCTACTCTGTGCAAGTACTGCTC No data
Right 1193132602 X:77933062-77933084 TGGAATGACAGCAGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193132600 Original CRISPR GAGCAGTACTTGCACAGAGT AGG (reversed) Intronic