ID: 1193133631

View in Genome Browser
Species Human (GRCh38)
Location X:77945591-77945613
Sequence ACATGTGTCTACAGGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193133631 Original CRISPR ACATGTGTCTACAGGGACTC TGG (reversed) Intronic
901016157 1:6232474-6232496 ACATGTGGCTCCTGGGATTCAGG - Intronic
902611438 1:17599909-17599931 ACATGTGGCTAGTGGGACTAAGG - Intronic
904286288 1:29454971-29454993 ACTGGAGTCTACAGGGACTGGGG + Intergenic
911533381 1:99072681-99072703 TCATGTGGCTAAAGGGACTCAGG + Intergenic
914243393 1:145867888-145867910 GCAAGTGTGTACAGGGACCCTGG + Intronic
914334806 1:146704587-146704609 ACATGTTGATTCAGGGACTCAGG - Intergenic
915359863 1:155279376-155279398 CCCTGTGTCCACTGGGACTCTGG - Intronic
916513858 1:165497454-165497476 GCATGTGTCTATAGCAACTCTGG + Intergenic
917125743 1:171686019-171686041 ACAGTTGGCTACAGGGATTCAGG + Intergenic
917965204 1:180174407-180174429 GCATGTTTCCCCAGGGACTCAGG + Intronic
918781264 1:188703234-188703256 ACATGAGTCTTGAGGGACTATGG - Intergenic
919913786 1:202127993-202128015 ACCAGTGAATACAGGGACTCGGG - Exonic
920284108 1:204867491-204867513 TCATGTGTCTATAGGTATTCAGG - Intronic
1063569857 10:7205205-7205227 ACACGTGTCTCCAGCTACTCTGG - Intronic
1065563201 10:26984003-26984025 ACCTGTTTCTACAGTGGCTCAGG - Intergenic
1065627379 10:27645537-27645559 ACATGTCTCTTCAAGGGCTCAGG - Intergenic
1065919219 10:30376759-30376781 AAATGTGCCTACCAGGACTCTGG - Intergenic
1066076191 10:31879866-31879888 ACATGCTTCTACAGGGTTTCTGG + Intronic
1069552984 10:69377248-69377270 ACAAGTGCCTTCAGGGAGTCCGG - Intronic
1069809024 10:71144859-71144881 AGATGTGCCTACAGGGCCTGAGG - Intergenic
1072249697 10:93571998-93572020 ACATCTGTCCACAGGCACTGTGG - Intronic
1074906187 10:117865841-117865863 AAATGTGTCTCCAGGGCCCCTGG - Intergenic
1076335205 10:129702299-129702321 ACATGTGACAACAGGGCGTCGGG - Intronic
1076847068 10:133074554-133074576 GCAGGTGTCTACAGGGACCACGG - Intronic
1077487909 11:2847499-2847521 ATATGTGTCCACAGGCATTCAGG - Intronic
1077922320 11:6650763-6650785 CCAGGTGTCTACTGGGGCTCTGG - Intronic
1080679330 11:34459488-34459510 ACCTGTGTCCTCAGGTACTCAGG - Intronic
1081424671 11:42912554-42912576 ACAGGTGTCAACAGGTATTCAGG + Intergenic
1081597044 11:44466608-44466630 ACAGGTGACTACAGGGAATGTGG + Intergenic
1087066733 11:94034417-94034439 ACATTAGTATACAGTGACTCAGG - Intronic
1088565030 11:111162346-111162368 ACATGTGCCTCCAGGAGCTCAGG + Intergenic
1089554266 11:119306798-119306820 ACATGTGTCAGCAGGAAGTCAGG - Exonic
1091978980 12:4850414-4850436 ACTTGACTCTAGAGGGACTCAGG + Intronic
1099387243 12:82029426-82029448 ACAAGGGTCCACAGGGATTCTGG + Intergenic
1102446385 12:113006081-113006103 ACATGTGGCTACAGCAACTGAGG + Intronic
1104585270 12:130043634-130043656 ACATGTGTGTACATGTATTCAGG - Intergenic
1105009374 12:132745221-132745243 ACCTGTGTCAACAGGGACATTGG - Intronic
1107195136 13:37642518-37642540 ATATTTCTCTTCAGGGACTCAGG + Intronic
1107995303 13:45853366-45853388 ACAAGTGGCTCCAGGGACTCAGG - Intergenic
1111196700 13:84883877-84883899 ACATGTGTATACTGGGAATAGGG + Intergenic
1115834259 14:37380106-37380128 ACAGCTGTCTACATGGACCCAGG - Intronic
1119105434 14:71919091-71919113 TCATGTGCCCACAGGGGCTCCGG + Intergenic
1121666547 14:95676813-95676835 ACATGTGCCCACTTGGACTCTGG + Intergenic
1121771836 14:96552087-96552109 ACATGGGACTACAATGACTCTGG - Intronic
1124687071 15:31791820-31791842 ACATTTGTCAACAGGGTCTGAGG - Intronic
1127091067 15:55468072-55468094 AAATGTGGCTACTGAGACTCAGG + Intronic
1127430393 15:58901444-58901466 ATATCTCTCTACATGGACTCTGG - Intronic
1127783195 15:62333544-62333566 ACATGTGTCTGGAGGGGATCTGG + Intergenic
1129982008 15:79881606-79881628 ACATGTATCTAAAAGTACTCTGG - Intronic
1130106719 15:80934325-80934347 ACATGTGGCCACTGTGACTCAGG - Intronic
1130288276 15:82573169-82573191 CCCTGTGTCCACAGGCACTCAGG + Intronic
1130962866 15:88675646-88675668 AAATGTGGCTACTGTGACTCAGG + Intergenic
1133883249 16:9803045-9803067 AGATTTGTCAACAGGGACTTTGG + Intronic
1138519139 16:57560899-57560921 ACTTGTGTCTCCAGCTACTCAGG - Intronic
1139427321 16:66890591-66890613 AGATGTGTTTAGAGTGACTCTGG + Exonic
1139998818 16:71006649-71006671 ACATGTTGATTCAGGGACTCAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1151235831 17:72719306-72719328 ACATGTGGCCACGGGGCCTCGGG - Intronic
1155257213 18:24009342-24009364 ACATGTGTCTACTGAGTCCCTGG - Intronic
1155290860 18:24340261-24340283 ACATGAGTCTACAATAACTCAGG - Intronic
1160426943 18:78784171-78784193 ACATGTGCCTCCAGGGTCTTAGG - Intergenic
1163348931 19:16763151-16763173 AGCTGAGTCTGCAGGGACTCTGG - Intronic
1163488828 19:17605495-17605517 ACAAATATCTAAAGGGACTCCGG + Exonic
1164742691 19:30588295-30588317 ATATGTATCTAAAGAGACTCTGG - Intronic
1164780885 19:30891560-30891582 GCATATGTCTATAGAGACTCTGG + Intergenic
1165064626 19:33221735-33221757 AGATGTGTGTTCAGTGACTCAGG - Intronic
1168127293 19:54292341-54292363 ACATGTGTCTCCAGACTCTCGGG - Intergenic
930735749 2:54776827-54776849 ACATTTGTATACTGGGACCCTGG + Intronic
936160921 2:110083678-110083700 ACATTTGTCTCCAGGGCTTCGGG - Intergenic
936183742 2:110287676-110287698 ACATTTGTCTCCAGGGCTTCGGG + Intergenic
937524925 2:122756712-122756734 ACATGTGCCTACAAGGATTTGGG - Intergenic
938843756 2:135186986-135187008 ACATGTGGCTACTGAGACTGAGG + Intronic
946171264 2:217897296-217897318 ACATGTGTCTTAAGGGACCCTGG - Intronic
947395143 2:229679082-229679104 AACTCTGTCTACAGGGCCTCTGG - Intronic
1169781137 20:9311916-9311938 AAATGTGGCTACTGGGACTGAGG + Intronic
1173056240 20:39616062-39616084 ACATGTATTTCCAGGGACGCTGG - Intergenic
1173576114 20:44113842-44113864 CCATGTTTCAACAGGGGCTCTGG - Intronic
1173661359 20:44736282-44736304 ACATGGTGATACAGGGACTCAGG + Intergenic
1175796082 20:61771861-61771883 ACATCTGTCTATAAGGACTTTGG + Intronic
1176612359 21:8995013-8995035 ACATGTGTTTATTGGGAATCAGG + Intergenic
1181038287 22:20180202-20180224 ACATGTGACTGCACAGACTCTGG - Intergenic
1181393782 22:22603661-22603683 GCATGTGTCTGCAGTGACACTGG - Intergenic
1184045126 22:41968397-41968419 AAATGTGTCTACAGTGACCAAGG - Intergenic
950260820 3:11542569-11542591 ACTGGTGTCTCCAGGGACCCAGG - Intronic
951887515 3:27538775-27538797 AGAAGTGGCTACAGGTACTCAGG - Intergenic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
954697250 3:52434502-52434524 ACAGGTGTCCACAAGAACTCAGG - Exonic
954844698 3:53545390-53545412 ACATGTGTGTAAAGGGAACCTGG - Intronic
959798489 3:110461605-110461627 ACATGTGTTGACAGGTACACAGG + Intergenic
961995643 3:131239124-131239146 ACATGGGTCCAGAGTGACTCTGG + Intronic
970434303 4:16018597-16018619 AAGTGTGTCTAAAGGGACTTGGG + Intronic
975696024 4:77013913-77013935 ACCTGTGTTTACAGGGATTAGGG + Intronic
978171069 4:105670871-105670893 ACTTGGCTCTACAGGGACTTTGG + Intronic
981698715 4:147584610-147584632 ACATTTTTCTACAAGCACTCAGG + Intergenic
985578333 5:684000-684022 ACAACAGTCTCCAGGGACTCTGG - Intronic
985593263 5:776140-776162 ACAACAGTCTCCAGGGACTCTGG - Intergenic
985838350 5:2287598-2287620 ACAGGTGTCTACAGGCATCCAGG - Intergenic
986237506 5:5925886-5925908 ACATGTAACTACAGGGTCACTGG + Intergenic
986697782 5:10373924-10373946 ACCTGTGGCTTCAGTGACTCTGG + Intronic
988893085 5:35640491-35640513 ACATTTGTCTAAAATGACTCAGG - Intronic
989359497 5:40584570-40584592 ATATGTGTCTACAGGGGAGCAGG - Intergenic
991725793 5:69534699-69534721 AAATGTGTCTGCAGGCACACAGG + Exonic
991869161 5:71093165-71093187 AAATGTGTCTGCAGGCACACAGG - Intergenic
992648946 5:78838423-78838445 AAATGTGTCACCAGGCACTCGGG - Intronic
996021467 5:118595123-118595145 ACATGTGTCTTCACGCACACTGG + Intergenic
998133463 5:139662587-139662609 GCATGTGGCTATAAGGACTCAGG + Intronic
999143117 5:149375913-149375935 ACATGTGGCTACTGTGACTGAGG - Intronic
999773532 5:154793281-154793303 GCACCTGTCTATAGGGACTCTGG + Intronic
1001384010 5:171323584-171323606 AAATGTCTCCAGAGGGACTCAGG - Intergenic
1004111558 6:12723618-12723640 GCATGTGCCTACAGGTACTTGGG - Intronic
1005013380 6:21356715-21356737 AGAAGTGGCTCCAGGGACTCAGG + Intergenic
1006316307 6:33293815-33293837 AGAGGTGGCTACAGGGGCTCCGG - Exonic
1006936852 6:37724534-37724556 ACAGGTCTCTTCATGGACTCTGG - Intergenic
1008940915 6:57044925-57044947 ACATAGGACTTCAGGGACTCGGG + Intergenic
1010743153 6:79530759-79530781 ACAAGTTTCTACAAGGACTAAGG - Intronic
1014526289 6:122505643-122505665 ACAGGTTTTTAAAGGGACTCAGG - Intronic
1017895751 6:158678199-158678221 TCATGTGTCTAAAGGATCTCTGG + Intronic
1017971236 6:159314484-159314506 ACATGTGTCCACATGCACACAGG - Intergenic
1028684121 7:93574346-93574368 AGGTGTGGCTCCAGGGACTCAGG + Exonic
1032480368 7:132241140-132241162 ACAGGACTCCACAGGGACTCTGG + Exonic
1032614958 7:133458441-133458463 ACATGTCACTCCAGGGACACAGG + Intronic
1038328431 8:26589634-26589656 AGATCTGACCACAGGGACTCAGG - Intronic
1040325672 8:46340312-46340334 AGATATGGCTGCAGGGACTCAGG + Intergenic
1040326112 8:46342431-46342453 ACATGTGACAACAGGGCCGCAGG + Intergenic
1044094600 8:88047620-88047642 ACCTGTGTCTACAAGGAGGCTGG + Intronic
1044731905 8:95235651-95235673 AAATTTGTCTCCAGGGACTCAGG - Intergenic
1049571231 8:143371193-143371215 ACAGGTGTCTCCTGGGACACAGG - Intronic
1049654226 8:143790734-143790756 ACATGGGTCTGCAGGCACTTGGG + Intergenic
1051700356 9:19816214-19816236 ACATGGTTATTCAGGGACTCAGG + Intergenic
1056887637 9:90458688-90458710 GCAGGTGGCCACAGGGACTCTGG - Intergenic
1057170396 9:92960013-92960035 ACATGGGAACACAGGGACTCGGG - Intronic
1059160636 9:112031848-112031870 TCATTTGTCTACAGGCACTCAGG - Intergenic
1061885820 9:133590702-133590724 CCATGTGTCTACTGGCTCTCGGG - Intergenic
1185766706 X:2731463-2731485 ACATGTATTTCCAGGTACTCGGG + Intronic
1189723041 X:43940121-43940143 ACATGAGCTTCCAGGGACTCTGG - Intergenic
1192835674 X:74796609-74796631 GCATGTGTTTAAAGGGACGCAGG + Intronic
1192867670 X:75152782-75152804 ACCTGTGACTACAGCTACTCAGG - Intronic
1193133631 X:77945591-77945613 ACATGTGTCTACAGGGACTCTGG - Intronic
1193366750 X:80643738-80643760 ACATTGGACTACGGGGACTCAGG + Intergenic