ID: 1193135807

View in Genome Browser
Species Human (GRCh38)
Location X:77969534-77969556
Sequence GTGGCCCGCCGGGCTCAGAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 3, 2: 2, 3: 9, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193135802_1193135807 -6 Left 1193135802 X:77969517-77969539 CCGCGCTTCGCCTCCTCGTGGCC 0: 4
1: 0
2: 2
3: 14
4: 133
Right 1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG 0: 1
1: 3
2: 2
3: 9
4: 73
1193135798_1193135807 2 Left 1193135798 X:77969509-77969531 CCTGCCCGCCGCGCTTCGCCTCC 0: 4
1: 0
2: 2
3: 32
4: 333
Right 1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG 0: 1
1: 3
2: 2
3: 9
4: 73
1193135800_1193135807 -3 Left 1193135800 X:77969514-77969536 CCGCCGCGCTTCGCCTCCTCGTG 0: 4
1: 0
2: 1
3: 9
4: 152
Right 1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG 0: 1
1: 3
2: 2
3: 9
4: 73
1193135797_1193135807 18 Left 1193135797 X:77969493-77969515 CCAGCATCTCGTAGCGCCTGCCC 0: 3
1: 0
2: 1
3: 9
4: 69
Right 1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG 0: 1
1: 3
2: 2
3: 9
4: 73
1193135799_1193135807 -2 Left 1193135799 X:77969513-77969535 CCCGCCGCGCTTCGCCTCCTCGT 0: 4
1: 0
2: 1
3: 12
4: 84
Right 1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG 0: 1
1: 3
2: 2
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193135807 Original CRISPR GTGGCCCGCCGGGCTCAGAT CGG Exonic
901732803 1:11292765-11292787 GTGGTCCGCAGGGCTCAGAGAGG - Intronic
902818277 1:18928293-18928315 CTGGGCAGCCGGGCTCTGATGGG - Intronic
903421476 1:23220423-23220445 GGGGCCCACGGGGCTCAGAGTGG + Intergenic
912716975 1:111989896-111989918 GTGGCCGGCCGGGCTCCGCTCGG - Intergenic
920185186 1:204155086-204155108 GTGGCCCCCAGGGCCCAGGTGGG + Exonic
920665357 1:207959359-207959381 GCGGCCCGCAGGGTTCAGACGGG - Intergenic
1064310129 10:14204927-14204949 GTGGCTCTCCGGGCTCTGTTGGG - Intronic
1067142943 10:43671372-43671394 GTGGACCACCGAGCTCAGAAGGG + Intergenic
1069735687 10:70652638-70652660 GTGGCCAGCTAGGCTCAGTTTGG - Intergenic
1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG + Intronic
1072670601 10:97426390-97426412 GTGGCCCGCCGGGCTCAGGTCGG - Exonic
1077459156 11:2700170-2700192 GATGCCACCCGGGCTCAGATTGG + Intronic
1083302018 11:61744502-61744524 GTGGCCAGCCGGGCCCAGGCAGG + Exonic
1084364127 11:68686450-68686472 CTGCTCCGCGGGGCTCAGATAGG - Intronic
1084922180 11:72480076-72480098 GAGGACCGCCAGGCCCAGATAGG + Intergenic
1086900981 11:92367146-92367168 GTGGCCTGCTGGGCTCAGGTTGG + Intronic
1088640795 11:111871255-111871277 GTGGCGCGCGGGGCTCAGTCCGG - Intronic
1089282534 11:117384531-117384553 CTGGGCAGCCGGGCTCAGTTGGG + Intronic
1089294033 11:117457459-117457481 GTGGCCCTGAGGCCTCAGATGGG + Intronic
1093960991 12:25272531-25272553 GAGGCCAGCCGGGCTAACATAGG + Intergenic
1097830362 12:64218006-64218028 GTGGCCCGCAGGCCACAGGTTGG + Intronic
1100337090 12:93641482-93641504 GTGGCCCGCCGGGCTCAGGTCGG + Intergenic
1100553792 12:95672385-95672407 GTGGCCTGCCGGGCTCAGGTCGG - Intronic
1101361373 12:104030861-104030883 GTGGCCCGCCGGGCTCAGGTCGG - Intronic
1103560310 12:121790068-121790090 GGGGCTCGCAGGGCTCAGAAGGG - Intronic
1106422631 13:29595975-29595997 GTGGCGCGGTGCGCTCAGATTGG - Intergenic
1109584927 13:64387113-64387135 GTGGCCCACGGGCCTCAGGTTGG + Intergenic
1110891747 13:80705220-80705242 GTAGGCCACCGGCCTCAGATAGG - Intergenic
1111338916 13:86858055-86858077 CTGACCAGCCAGGCTCAGATGGG - Intergenic
1119678093 14:76571328-76571350 GTGGCCCGCAGGCCACAGGTTGG - Intergenic
1121408313 14:93732813-93732835 CAGCCCCGCCGGGCTCAGCTGGG - Intronic
1122530938 14:102426487-102426509 GAGGCCCGCTGAGCTCAGAATGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1128454886 15:67826892-67826914 GTGGCCCGGCGGGCCCAGGAGGG + Exonic
1132829251 16:1919415-1919437 GAGGCGAGCCGGGCTCAGAGAGG + Intergenic
1132884482 16:2176619-2176641 GTGGCCAGCCTGGCTCAGAAAGG - Exonic
1134050926 16:11136842-11136864 GGGGACTGCCTGGCTCAGATGGG - Intronic
1138512131 16:57515015-57515037 GGGGCCAGCAGGGCTCAAATAGG - Intronic
1147311617 17:39599175-39599197 CCGGCCGGCCGGGCTCAGAGCGG - Intergenic
1149614853 17:57988568-57988590 CTGGCCCGCTGGGCACAGCTGGG + Intergenic
1152064859 17:78105304-78105326 GTGGACCGCCGGGCGCAGAGCGG + Exonic
1160514465 18:79470825-79470847 GGGGGCCCCCGGGCTCAGGTGGG + Intronic
1165089324 19:33374256-33374278 GTGACCCGCCAGGCTCGCATTGG + Intronic
927537210 2:23872910-23872932 ATGGCCCGCCGGGCTCACATTGG + Intronic
933188863 2:79310906-79310928 GTGGCCATCTGTGCTCAGATTGG + Intronic
938116501 2:128606184-128606206 GTGTCCCGCAGGGCTGAGAAAGG - Intergenic
941812266 2:169767029-169767051 GCGGCCAGCTGGGCTCAGAGTGG + Intronic
948562903 2:238865912-238865934 GTGCCCCGCCGGGGTCGGATCGG + Intronic
1168888373 20:1276135-1276157 GTGGCACGCAGGGCCCAGATTGG + Intronic
1171293372 20:23995205-23995227 GGAGCCCACCGGGCCCAGATAGG + Intergenic
1179241816 21:39599440-39599462 GGGGCCAGGCGGGCTCAGCTGGG + Intronic
1180194608 21:46185078-46185100 GGGCCCCGTCGGGCTCAGAGCGG - Intergenic
1180824430 22:18852921-18852943 GGAGCCCACCGGGCCCAGATAGG + Intronic
1181188304 22:21121627-21121649 GGAGCCCACCGGGCCCAGATAGG - Intergenic
1181210894 22:21288866-21288888 GGAGCCCACCGGGCCCAGATAGG + Intergenic
1181398614 22:22638022-22638044 GGAGCCCACCGGGCCCAGATAGG - Intergenic
1181501347 22:23317378-23317400 GGAGCCCACCGGGCCCAGATAGG - Exonic
1181650806 22:24258038-24258060 GGAGCCCACCGGGCCCAGATAGG + Intergenic
1181706575 22:24652701-24652723 GGAGCCCACCGGGCCCAGATAGG - Intergenic
1184266523 22:43349853-43349875 GGGGCACGCCGGGCACAAATGGG - Intergenic
1203216053 22_KI270731v1_random:6564-6586 GGAGCCCACCGGGCCCAGATAGG - Intergenic
949965008 3:9348525-9348547 ATGGCCCGCTGGGCTCAGGTCGG - Intronic
950912120 3:16605429-16605451 GTGGTCCGCGGGGCTCAGGGAGG + Intronic
953636816 3:44671169-44671191 GTGGCCCACCAAGCTAAGATGGG - Intergenic
955751163 3:62186510-62186532 GTGGCCCATCGGCCTCAGAGGGG + Intronic
955807591 3:62753730-62753752 GTGGCCCGCATGGTTCAGAGTGG - Exonic
962539660 3:136366632-136366654 GTGGCCTGACAGGCACAGATGGG - Intronic
968503374 4:961213-961235 GAGGCCAGCCGGGCTCAGCGGGG + Intronic
968503418 4:961332-961354 GAGGCCAGCCGGGCTCAGCGGGG + Intronic
977924646 4:102686418-102686440 GTGGCCAGTTGGGATCAGATTGG - Intronic
977941949 4:102868919-102868941 GTGACCTGCCGGGCGCCGATTGG - Intergenic
982883684 4:160750920-160750942 GTGGCCTGCCTTGCTCAGTTGGG + Intergenic
991279871 5:64900897-64900919 GTGGCCCACTGGCCACAGATTGG - Intronic
993402209 5:87467514-87467536 GTGGCCAGCTTGGCTGAGATTGG - Intergenic
997393068 5:133532767-133532789 GTGGCCATCCTGGCTCAGAAAGG + Intronic
1003113840 6:3270317-3270339 TGGGCCCGCCGGGCTCAGCAGGG - Exonic
1007418451 6:41705686-41705708 AGGGCCCCCCAGGCTCAGATGGG + Intronic
1010178286 6:73055179-73055201 ATGGCCCGCTGGGCTCAGGATGG - Intronic
1016949668 6:149567002-149567024 GGGCTCCGCCGGGCTCAGGTGGG + Intronic
1021696968 7:23285310-23285332 GTGGCCCGTGGGCCACAGATTGG - Intergenic
1025638241 7:63343317-63343339 TTGGCATGGCGGGCTCAGATTGG - Intergenic
1025644455 7:63404772-63404794 TTGGCATGGCGGGCTCAGATTGG + Intergenic
1028638265 7:93015409-93015431 GTTGCCACCCGGGCTTAGATGGG - Intergenic
1042015104 8:64300339-64300361 GTGGCCTGCCTGGCTCTGATGGG + Intergenic
1056136245 9:83631895-83631917 GTGCCCCTGCAGGCTCAGATAGG - Intronic
1062696734 9:137879529-137879551 GTGCCCTGCTGGGCTGAGATGGG + Intronic
1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG + Exonic
1199955863 X:152741981-152742003 CTGGCCTCCCTGGCTCAGATGGG + Intergenic