ID: 1193142344

View in Genome Browser
Species Human (GRCh38)
Location X:78041222-78041244
Sequence ATTTATTAGAAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193142344_1193142349 28 Left 1193142344 X:78041222-78041244 CCTTCTCCCCTCTTCTAATAAAT No data
Right 1193142349 X:78041273-78041295 TTGTTTCTTTTTTTTTTCTTGGG No data
1193142344_1193142348 27 Left 1193142344 X:78041222-78041244 CCTTCTCCCCTCTTCTAATAAAT No data
Right 1193142348 X:78041272-78041294 TTTGTTTCTTTTTTTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193142344 Original CRISPR ATTTATTAGAAGAGGGGAGA AGG (reversed) Intronic
No off target data available for this crispr