ID: 1193142344

View in Genome Browser
Species Human (GRCh38)
Location X:78041222-78041244
Sequence ATTTATTAGAAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193142344_1193142348 27 Left 1193142344 X:78041222-78041244 CCTTCTCCCCTCTTCTAATAAAT 0: 1
1: 0
2: 3
3: 33
4: 386
Right 1193142348 X:78041272-78041294 TTTGTTTCTTTTTTTTTTCTTGG 0: 2
1: 30
2: 762
3: 17365
4: 36027
1193142344_1193142349 28 Left 1193142344 X:78041222-78041244 CCTTCTCCCCTCTTCTAATAAAT 0: 1
1: 0
2: 3
3: 33
4: 386
Right 1193142349 X:78041273-78041295 TTGTTTCTTTTTTTTTTCTTGGG 0: 2
1: 22
2: 648
3: 17048
4: 31846

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193142344 Original CRISPR ATTTATTAGAAGAGGGGAGA AGG (reversed) Intronic
900318670 1:2071668-2071690 ATGGATTAGAAGAGAGGAGTTGG + Intronic
902288006 1:15419121-15419143 AGTTATCAGAACTGGGGAGAGGG + Intronic
902714947 1:18266215-18266237 ATTTTATAGAAAAGGAGAGAGGG + Intronic
902804650 1:18853512-18853534 AGTTATTTGAGGATGGGAGAGGG + Intronic
903690918 1:25172990-25173012 ATTTATAAGAAGAAAGGTGAAGG + Intergenic
906488932 1:46252535-46252557 ATTGATTACATGTGGGGAGAGGG + Intronic
906860143 1:49350547-49350569 ATTTATTGAAAGAGGTGAGGTGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907446775 1:54513192-54513214 ATTTAGTAGAAGGGGGGGGGGGG + Intergenic
907964396 1:59315282-59315304 ATTGATGGGAGGAGGGGAGAAGG - Intronic
908041109 1:60114590-60114612 TTTTGTTATAAGATGGGAGAAGG + Intergenic
908916224 1:69129638-69129660 TTTTATTAAAAGAGGGGTGAGGG + Intergenic
909072979 1:71018473-71018495 GTTTATAAAAAGAGGGGAAAGGG - Intronic
909205235 1:72748131-72748153 ATCTATTATAAGAGAGAAGAAGG + Intergenic
909259518 1:73469188-73469210 ATTTTTTAGGAGAGGTGAGGCGG + Intergenic
910130707 1:83902088-83902110 ATTTATTCTAACAGGGGGGAAGG - Intronic
910391552 1:86750511-86750533 ATTTTTTGAAAGAAGGGAGAGGG - Intergenic
911266260 1:95747734-95747756 GTTGAATAGAAGAGGTGAGAGGG + Intergenic
912226837 1:107743370-107743392 ATTGATTACAAGTGGAGAGAGGG + Intronic
913454309 1:119015435-119015457 ATTTATAAGCAGAGGGGATTAGG - Intergenic
913575119 1:120164430-120164452 ACTTACTAGAAGAGGAGGGAAGG - Intronic
913965068 1:143370059-143370081 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914059444 1:144195661-144195683 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914119706 1:144770710-144770732 CTTTATAACAAGAGGAGAGAAGG - Intergenic
914557424 1:148780071-148780093 ACTTACTAGAAGAGGAGGGAAGG - Intergenic
914615410 1:149350159-149350181 ACTTACTAGAAGAGGAGGGAAGG + Intergenic
915000820 1:152588687-152588709 ATTTAATAGGAGTGGTGAGAAGG - Intronic
915263206 1:154694492-154694514 TTTTGTTTGATGAGGGGAGAGGG - Intergenic
915321043 1:155056683-155056705 ATTTCTTAGAGGAGGGTAGGAGG + Intronic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
915630690 1:157152065-157152087 ATTTACTAGAAGGAAGGAGAGGG - Intergenic
915749234 1:158189329-158189351 ATTTATTTGAAGTCTGGAGATGG + Intergenic
915987825 1:160483816-160483838 ATTTATGATAAAAAGGGAGAAGG + Intergenic
916499091 1:165371132-165371154 ATTTATAAAAAAAGAGGAGATGG - Intergenic
916986217 1:170194089-170194111 ATTGAATAGAAGTGGGGAAAGGG + Intergenic
917124523 1:171674967-171674989 ACTTAATGGAAGAGGGTAGAAGG - Intergenic
917503140 1:175604128-175604150 ATTCATTAGAAGAGGGGAGCGGG - Intronic
917994469 1:180420899-180420921 ATTTATTAGTAAGGGAGAGAAGG - Intronic
918052096 1:180982764-180982786 GTTTTTAAGTAGAGGGGAGAAGG + Intronic
918111923 1:181462562-181462584 ATTTATTTGAAAATGGGAGAGGG - Intronic
918484231 1:185012320-185012342 AGTTGTTTGAAGAGGGTAGAAGG - Intergenic
918496291 1:185141092-185141114 ATTCATTACAAAATGGGAGATGG + Intronic
918959190 1:191249882-191249904 AATAACTAGAAGAGGGGAAATGG - Intergenic
919857847 1:201717849-201717871 AATTACTAGAAGAGAGGTGATGG + Intronic
920788146 1:209062496-209062518 AGCTCTTAGAAGAGGGTAGAAGG + Intergenic
920808439 1:209257327-209257349 ATTTGTTTGAAGATTGGAGAAGG + Intergenic
921491581 1:215783114-215783136 ATTTATTAGATGCAGGGATACGG + Intronic
921556323 1:216602254-216602276 ATTTACTAGAAGAGGCTAAAGGG + Intronic
922194795 1:223350682-223350704 CTTGATTAGAAGAGGGCTGAAGG - Intronic
923374767 1:233350055-233350077 GCTAATTAGAAGAGGGGAGAGGG - Intronic
923718657 1:236448524-236448546 ATATATTAGAAATGGGGAAAGGG - Intronic
923734496 1:236591601-236591623 ATTGATTAGCAAGGGGGAGATGG - Intronic
1063713780 10:8507075-8507097 ATTTATTAGATGAGGGGCAGAGG + Intergenic
1065445557 10:25794923-25794945 ATGATTTAGAAGAGGAGAGAAGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066320890 10:34302796-34302818 ATTTTTCAGAAGAAGGCAGATGG + Intronic
1068283067 10:54901758-54901780 ATTTATTAAAAGAGGCAATAGGG - Intronic
1068941825 10:62688177-62688199 GGTTATTACAAGAGGGGACAGGG - Intergenic
1069520038 10:69111698-69111720 ATTTGTTAGATAAGGGGACAGGG - Intergenic
1070541938 10:77421990-77422012 ATTTGTTAGAAGAGGAATGATGG - Intronic
1071794207 10:88988181-88988203 ATAGTTAAGAAGAGGGGAGAGGG + Intronic
1071887084 10:89963088-89963110 AATTTCTAGAAGAGGGAAGAGGG + Intergenic
1071887290 10:89964854-89964876 AGTTCCTAGAAGAGGGAAGAGGG + Intergenic
1072290081 10:93956633-93956655 ATCTCTTAGGAGAGTGGAGATGG + Intergenic
1072551768 10:96483718-96483740 ATTTGTTACAAGAGGGGAGGAGG + Intronic
1072755210 10:98016115-98016137 ATTTTTATGAAGAGGTGAGAAGG + Intronic
1073161081 10:101395950-101395972 ATTTTTTATATGATGGGAGAAGG + Intronic
1073378471 10:103057840-103057862 ATTCAGTAGATGAGGTGAGAAGG + Intronic
1074309092 10:112306718-112306740 ATTTATGTGAAGAGGAGAGGAGG - Intergenic
1074558197 10:114511353-114511375 ATTTTTTTAAAGAGGTGAGAAGG - Intronic
1076090338 10:127680172-127680194 TTCTATGATAAGAGGGGAGAAGG - Intergenic
1076202395 10:128568928-128568950 TTTGATGAGAGGAGGGGAGAAGG + Intergenic
1076248270 10:128964486-128964508 ATATAGGAGGAGAGGGGAGACGG - Intergenic
1077933585 11:6759138-6759160 AGTGATTAGAAGAGGGCATAAGG - Intergenic
1078506774 11:11956441-11956463 TTCTATTAGAAAAGGGGACAGGG + Intronic
1078704024 11:13720868-13720890 ATTTATTATAAGTAGGGAAAGGG - Intronic
1081365546 11:42230663-42230685 ATTTATTGGTAGAGAGGAGCAGG + Intergenic
1081842489 11:46212982-46213004 ATTGAGTAGAAGAGGGGAACAGG - Intergenic
1082207685 11:49457782-49457804 ATCTATTAACAGAGGTGAGAAGG - Intergenic
1083954436 11:65975783-65975805 AGTTTTTTAAAGAGGGGAGATGG + Intronic
1084920296 11:72464287-72464309 ATATATGAGGGGAGGGGAGATGG - Intergenic
1086428498 11:86712140-86712162 ATTTGTTTTAAGAGGGCAGATGG + Intergenic
1086647588 11:89243954-89243976 ATCTATTAATAGAGGTGAGAAGG + Intronic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087633969 11:100682543-100682565 ATTTATGAGGGGTGGGGAGAAGG - Intergenic
1087947021 11:104175089-104175111 TTTTATTAGAAAAGAGGGGAGGG - Intergenic
1088906198 11:114157134-114157156 ATTTTTTAGGGGAGAGGAGAGGG + Intronic
1090173404 11:124625240-124625262 ATTTATTAGATGTGGCAAGATGG - Intronic
1090516051 11:127428260-127428282 AGTTATTAAAGGAAGGGAGATGG - Intergenic
1091516506 12:1188352-1188374 ATCTAATAGAAAAGGAGAGAGGG - Intronic
1092087287 12:5773599-5773621 ATGGATTAGAAAAGGGGAAATGG + Intronic
1092755417 12:11758651-11758673 AGGTATTAGAAGAGTGGGGAAGG - Intronic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094488267 12:30941910-30941932 ATTTAAAAGAAGTGGGAAGAAGG - Intronic
1095581802 12:43808445-43808467 AATTATCACAGGAGGGGAGATGG + Intergenic
1095732209 12:45518591-45518613 TTTTACTAGAAGAGGGAAGCCGG + Intergenic
1096116128 12:49056319-49056341 ATTTCTTAGAAGAAGGGACAAGG - Intronic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096767380 12:53903704-53903726 ATTTATTAGAAAATGGGCAAAGG + Intergenic
1096933661 12:55243493-55243515 GTTTGTTAGGAGAGGTGAGATGG - Intergenic
1097331656 12:58338310-58338332 TTTTGATAGAAGAGGGAAGAAGG - Intergenic
1098020555 12:66150871-66150893 ATGTAATAGAACAAGGGAGAGGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1099769680 12:87034934-87034956 TTTGATTAGAAGAGAGGATAAGG - Intergenic
1099784575 12:87244541-87244563 ATTAATTAGAGAAGGTGAGATGG + Intergenic
1100644238 12:96512012-96512034 ATTAATTAAAAGAGGATAGAAGG - Intronic
1101154543 12:101915313-101915335 CTTTAGTAAAAGAGGGTAGAGGG + Intronic
1101210207 12:102528057-102528079 TTTTATTGGGATAGGGGAGATGG + Intergenic
1101344540 12:103874039-103874061 ATTAAATAGAAGTGGTGAGAAGG - Intergenic
1101916571 12:108900573-108900595 ATTCATTGGCTGAGGGGAGAAGG - Exonic
1103060628 12:117855574-117855596 ATTTCCTAGAGGAGGGGAGAAGG + Exonic
1103162591 12:118742429-118742451 ATTTATTAGAAGAATGGTGCTGG + Intergenic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104252995 12:127113692-127113714 AACTATGAGAAGTGGGGAGAAGG + Intergenic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1105544640 13:21342609-21342631 AGTTTTTGGAAGAGGGGAGGGGG - Intergenic
1106300942 13:28464832-28464854 ATTTATTAGAAAAAAAGAGATGG + Intronic
1106308196 13:28532118-28532140 ATTTTTTAAAAGAAAGGAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106774492 13:32995456-32995478 TTTTGGTAGAGGAGGGGAGATGG - Intergenic
1106961399 13:35002511-35002533 AACTATTAGAAGAGGGGACATGG - Intronic
1107631482 13:42347636-42347658 GACTATTAGATGAGGGGAGAGGG - Intergenic
1108109680 13:47055487-47055509 CTTTATTAGCAGAGTGGAAATGG - Intergenic
1108125601 13:47239374-47239396 ATGTCTCAGAAAAGGGGAGAAGG + Intergenic
1109134726 13:58633113-58633135 ATTTATAAAAAGAGATGAGATGG + Intergenic
1109878182 13:68432496-68432518 ATTGATTAGAAAGGGGAAGAAGG - Intergenic
1110070682 13:71173218-71173240 AATTCTTAGAAGTTGGGAGATGG + Intergenic
1110283007 13:73717531-73717553 ATTTATTAGTAAAAGGGAGAAGG - Intronic
1110718698 13:78737453-78737475 ATTTGATAGAAAAGGGAAGAAGG + Intergenic
1111952876 13:94724059-94724081 GTTTGGTAGAAGAGGGGAGGTGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113408030 13:110060012-110060034 ATTTCTTATAAGAGGTGAGTCGG - Intergenic
1114523922 14:23356332-23356354 ACTAACTAGATGAGGGGAGAGGG - Intergenic
1114672940 14:24422231-24422253 ACTTATTAGCTGAGGGGAAATGG - Intergenic
1114697626 14:24642541-24642563 AATTATTAGAAGCTGGGAAAGGG - Intergenic
1114724519 14:24921537-24921559 CTTTACTATAAGAGGGTAGAAGG + Intronic
1115921157 14:38375481-38375503 TTTTATTACAGCAGGGGAGATGG - Intergenic
1116266974 14:42704730-42704752 ACTAATTAGAAGAGGGGCCATGG + Intergenic
1116377846 14:44226633-44226655 ATATAATAGATGATGGGAGATGG + Intergenic
1116888131 14:50240393-50240415 ATTTATTCTAAGAGTGGATATGG - Intronic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1118512368 14:66489512-66489534 ATATAATAGAAAAGGGGAGGAGG - Intergenic
1118904765 14:70015766-70015788 ATCTCCAAGAAGAGGGGAGAAGG + Intronic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1125724719 15:41862426-41862448 AGTTATTTGAAGGGTGGAGAAGG + Intronic
1127082531 15:55394495-55394517 ATCTGTTAGAAGATGGGAGCAGG - Intronic
1127374732 15:58374030-58374052 ACGTATGAGAAGAGGGGAGTGGG + Intronic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1128745036 15:70107792-70107814 ATAGATTAAAAGAGGGGAAAAGG + Intergenic
1129445164 15:75612001-75612023 AGTTATGAGAAGAGGTCAGAGGG - Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130702114 15:86194695-86194717 AGTTAGTATAAGAGGGAAGATGG + Intronic
1131763100 15:95645763-95645785 ATTGCATAGAAGAGGGGACAGGG - Intergenic
1132080300 15:98858514-98858536 ATTCATTTCAAGAGGGGAGAGGG - Intronic
1133610131 16:7425734-7425756 ATTTGTTAAAAGAGGGAGGAGGG - Intronic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1138924241 16:61571261-61571283 GGTTATTAGCAGTGGGGAGAGGG - Intergenic
1139561932 16:67748663-67748685 AGGTGTTAGAAAAGGGGAGAGGG + Intronic
1140161570 16:72500895-72500917 TTTTATTTGAAGTGGGGGGAGGG - Intergenic
1143062335 17:4212374-4212396 ATTTTATAGAGGAGGAGAGAGGG - Intronic
1143592338 17:7893208-7893230 ATTTAATTGATGAGGGGAGATGG + Intronic
1143773165 17:9181149-9181171 CTTTGTTAGAGGAGGAGAGAAGG - Intronic
1143929179 17:10403209-10403231 AATTATTGGGAGAGGGGAGAGGG - Intronic
1145872906 17:28290390-28290412 ATATAATAGAAAAGGGGAAATGG - Intergenic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1148507686 17:48141086-48141108 ATTGATTAGAAGAGGGGGATGGG - Intronic
1148756274 17:49974622-49974644 ATCTATTCAAAAAGGGGAGATGG - Exonic
1148960342 17:51387250-51387272 AATTATTGGAAGATGGGAGGAGG - Intergenic
1149374314 17:56028990-56029012 ATTTAATAGCAGAGGGCAGGAGG + Intergenic
1149404462 17:56333434-56333456 ATATATTAAAAGAGAGGACAAGG - Intronic
1151324535 17:73370761-73370783 CTTTTTTAGAAAGGGGGAGAGGG + Intronic
1152307587 17:79530331-79530353 ATTTATTCGCAGAGGGACGAGGG - Intergenic
1153386179 18:4499257-4499279 ATTTATTTCAAAAGGGGAGTTGG + Intergenic
1153938636 18:9955898-9955920 AGTTACCAGAAAAGGGGAGAGGG - Intronic
1155001768 18:21694650-21694672 AGTTGTTAGAAGAGGGCAAAAGG - Intronic
1155381050 18:25223239-25223261 ATTTACTTGGGGAGGGGAGAAGG + Intronic
1157029591 18:43889667-43889689 GTCTATGAGAAGAAGGGAGAAGG + Intergenic
1157571417 18:48714826-48714848 ATTTTGTAGAAGAAGGGACAGGG - Intronic
1158548020 18:58412193-58412215 AGCTATTAGAAGAAGGGGGATGG - Intergenic
1158564066 18:58539321-58539343 GTTTTTGAGAAAAGGGGAGAGGG + Intronic
1159283199 18:66313771-66313793 ATATACTAGAAGAGGGGAATAGG + Intergenic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1163710986 19:18846682-18846704 GTAGATTAGAAGAGGGGAGAAGG + Intronic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1164515985 19:28935879-28935901 ATTTATTAAAAGAGCCGAGAGGG + Intergenic
1165071929 19:33260837-33260859 ATTTATCAGAACAGGAAAGATGG - Intergenic
1165695476 19:37897574-37897596 ATTTTTTAAAACAGGGGAGGAGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166387576 19:42390713-42390735 AATAACAAGAAGAGGGGAGATGG + Intergenic
1167275222 19:48534031-48534053 AGGGATGAGAAGAGGGGAGATGG - Intergenic
1167280044 19:48561803-48561825 ATTTTGGAGAAGAGGGGAGTGGG - Intronic
1202698846 1_KI270712v1_random:147548-147570 CTTTATAACAAGAGGAGAGAAGG + Intergenic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
925864293 2:8212705-8212727 ATTTATAAAAAGAGTGGGGAAGG - Intergenic
926304439 2:11627922-11627944 ATTAATAAGATGAAGGGAGAGGG + Intronic
927165330 2:20314135-20314157 ATTTATTTGCAGTGGGGAGCAGG - Intronic
927432670 2:23040304-23040326 ATTTTTTAGAAAGTGGGAGAGGG - Intergenic
928665172 2:33543676-33543698 AATTATTATCAGAGGAGAGAAGG + Intronic
928708879 2:33982265-33982287 ATTTCTTATAAGAGTAGAGAAGG + Intergenic
929133147 2:38598193-38598215 ATTAATTAGACGGGGGAAGAGGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929724031 2:44405011-44405033 ATTTCTTAGACAAGGGGAAAAGG + Intronic
929861242 2:45679672-45679694 ACTTACAAGAAGAGGGGATATGG + Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930725532 2:54677789-54677811 ATTTCTCAGAAGAGGAAAGAGGG + Intergenic
933526237 2:83443608-83443630 ATTTTTTATTGGAGGGGAGATGG - Intergenic
934169794 2:89531024-89531046 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934280096 2:91605332-91605354 CTTTATAACAAGAGGAGAGAAGG + Intergenic
935525469 2:104161379-104161401 ATTTATTAGAAATAGGGACAAGG - Intergenic
935530468 2:104226719-104226741 ATTTGTTAGAAGAGGAAAAAAGG + Intergenic
937036025 2:118782965-118782987 TTTTAATAGAAGAGGTGACAGGG + Intergenic
937188271 2:120067116-120067138 ATTTATTAAAAGATGAGAGATGG + Intronic
939527137 2:143309619-143309641 ATCAATTAGAAAAGGGGAGGTGG + Intronic
941102093 2:161308005-161308027 TTTTTTTAAAAGAGGGGGGATGG - Intergenic
942772652 2:179540638-179540660 ATTTTTTGGAAGAGAGGAAAGGG - Intronic
945046817 2:205789140-205789162 TTTTATTAGAAGGGGGCAGTAGG + Intronic
945200712 2:207278202-207278224 ATTTAGCAGCAGAGGAGAGAAGG - Intergenic
945253149 2:207781281-207781303 ATTTAATAGCAGAGGTAAGATGG - Intergenic
945420979 2:209636080-209636102 ATTCATTAGAAAAGTGCAGAGGG - Intronic
945434417 2:209802131-209802153 AGTTATCAGAAGCTGGGAGAGGG + Intronic
945654486 2:212606466-212606488 ATCTCTTGGAAGAGGGAAGAGGG + Intergenic
945838373 2:214858986-214859008 ATTTAAAAGGAGAGGGGAGAAGG - Intergenic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946949714 2:224860316-224860338 ATTTATCAGAAAAGGGGACTTGG + Intronic
947175239 2:227359768-227359790 AATTACTAGAAGTGGGGAGAAGG - Intergenic
947196995 2:227578260-227578282 ATTTGTCTAAAGAGGGGAGAAGG - Intergenic
947358202 2:229318647-229318669 ATTTATGAAAAGGGGGGAAATGG - Intergenic
1169524973 20:6414464-6414486 ATTTCTAAGAAAAGGGAAGAAGG + Intergenic
1170942712 20:20862547-20862569 AATTATTATAATAGAGGAGATGG - Intergenic
1171991443 20:31699627-31699649 ATTTATTCCAAGAGTGGAGCAGG + Intronic
1172659499 20:36557910-36557932 ATTTTTTAGAAAGGGGGAAAAGG + Intergenic
1172730938 20:37087034-37087056 ATCTATTAAAAGAGGGGATGAGG + Intronic
1172890823 20:38262615-38262637 AGGAATTAGAAGAGTGGAGATGG + Intronic
1174435568 20:50504322-50504344 GTTTATTAGAAGTGGTCAGAAGG + Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1176286874 21:5023053-5023075 ATTTCCTAGAAGAAGGGAGAAGG + Intronic
1176717861 21:10368512-10368534 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1177198403 21:17927498-17927520 ATTTAATAGAGGACAGGAGAAGG + Intronic
1177592175 21:23185083-23185105 TTTTACTTGAAGAGAGGAGATGG + Intergenic
1177919127 21:27128618-27128640 ACCTATTAGCAGAGGAGAGAAGG - Intergenic
1179870307 21:44240422-44240444 ATTTCCTAGAAGAAGGGAGAAGG - Intronic
1180299087 22:11021418-11021440 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1180686934 22:17676169-17676191 ATTTTATATAAGAGGAGAGACGG + Intronic
1180927247 22:19564654-19564676 ATTGACTAGAAGAGGGTATAGGG - Intergenic
1181449305 22:23007553-23007575 ATTTAGAAGAAGAGGGCATATGG + Intergenic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1182292371 22:29290874-29290896 AATTACTTAAAGAGGGGAGAGGG - Intronic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
949967265 3:9368192-9368214 ATTTTTTAAAAGAGGGGGGTGGG - Intronic
950005235 3:9687172-9687194 GAATCTTAGAAGAGGGGAGAGGG + Intronic
950845510 3:16011866-16011888 GTTTCTTAGAAAAGGGGAGGGGG + Intergenic
951099352 3:18668760-18668782 ATTTTGAAGATGAGGGGAGAGGG - Intergenic
951569992 3:24051983-24052005 ACATAATAGAAGAAGGGAGATGG - Intergenic
954848169 3:53577950-53577972 ATTTATTTTAAGAGGGGGGTTGG + Intronic
955663426 3:61325758-61325780 ATTTATTAGAAATTGGGTGATGG - Intergenic
955892875 3:63668759-63668781 CTTTATAAGAAAGGGGGAGAGGG + Intronic
955929024 3:64037176-64037198 GTTTCTTAGAAGATGGGAGAAGG - Intergenic
956562156 3:70591203-70591225 ATTGATCAGAAGTGAGGAGAAGG - Intergenic
957814391 3:85274395-85274417 ATGTCTTAGAAGAGATGAGAAGG + Intronic
957991980 3:87637326-87637348 TTTGATTAAAAGAAGGGAGAGGG - Intergenic
958831165 3:99091406-99091428 AGTTAATAGAAGGAGGGAGAAGG - Intergenic
958839469 3:99186330-99186352 TTCTATTTGAAGAGAGGAGAAGG + Intergenic
959800214 3:110485238-110485260 ATTTGTAATAAAAGGGGAGAGGG + Intergenic
960321741 3:116245146-116245168 CTTTATAAGAAGAGGAGACAAGG + Intronic
961341327 3:126222750-126222772 ATTTAATAGAAGTAGTGAGAGGG - Intergenic
961838432 3:129685071-129685093 ATGTATTAAAAGAAGGGAAAGGG + Intronic
962537959 3:136348176-136348198 ATTTATTAGAAGCATGAAGAAGG + Intronic
963566180 3:146933845-146933867 ATTTATTAAAAGGGGGTTGAGGG + Intergenic
964008194 3:151856580-151856602 ATTTATAAGAAGAGGTGATCAGG - Intergenic
964404050 3:156330125-156330147 CTTTATTATAAAAGGGGGGATGG - Intronic
964448429 3:156785358-156785380 ATCTATAAGATGAGGGGATATGG - Intergenic
964853964 3:161125488-161125510 TTTTTTTATAATAGGGGAGAGGG + Intronic
964858751 3:161176518-161176540 TTTTGTTTGAAGAGGGGATAAGG + Intronic
965895981 3:173576626-173576648 TTTTATTAGAGGAAGGCAGAGGG - Intronic
966660905 3:182413401-182413423 ATTTTTTAAAAGGGGGGAAAAGG + Intergenic
966684205 3:182676330-182676352 GTAATTTAGAAGAGGGGAGATGG - Intergenic
966723728 3:183089715-183089737 ATTTACTAGATGAGGGGGGAAGG + Intronic
967441017 3:189509101-189509123 AAATATTACAAAAGGGGAGATGG - Intergenic
968178904 3:196575524-196575546 ATTTATAAGAATTGGGGAGTAGG + Intronic
968824519 4:2884735-2884757 ATTTAGGAGAAGAGGGAAGCAGG + Intronic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969897148 4:10316089-10316111 CTTTAGTATAAAAGGGGAGACGG + Intergenic
970381875 4:15516767-15516789 ATTTAATAAAAGTGGAGAGAGGG - Intronic
970548383 4:17153603-17153625 ATTGAGAAAAAGAGGGGAGAGGG + Intergenic
970589135 4:17544106-17544128 ATTTATTTGAAGAAAGCAGAAGG - Intergenic
972207743 4:36798437-36798459 TTTCATTTGAAGAGAGGAGAGGG + Intergenic
973785709 4:54331021-54331043 GTTATTTAGAAGAGGGCAGAAGG + Intergenic
975419388 4:74144666-74144688 AGTTATTAAAAGTGGGGAGGTGG - Intronic
977291009 4:95164199-95164221 ATTTTTGAAAAGTGGGGAGATGG - Exonic
977530031 4:98190043-98190065 ATTCATTAGAAGAGGCATGAGGG - Intergenic
978344057 4:107747840-107747862 ATTTATTAGAAAGAGGGAGCAGG - Intergenic
979688111 4:123533370-123533392 ATTGAATAGAAGTGGTGAGAGGG - Intergenic
980405489 4:132349809-132349831 ATTTATTAGAAAAAGGGAGATGG - Intergenic
980419106 4:132536899-132536921 AATAAGTAGAAGAGAGGAGAAGG - Intergenic
981239199 4:142454727-142454749 ATTTATTATAAGGGGGAATAAGG - Intronic
981931404 4:150192756-150192778 AGTTGTTAGGAGAGGGAAGAAGG + Intronic
983558774 4:169081098-169081120 TTTTAACAGAAGAGGGGAAAGGG + Intergenic
984836572 4:184028090-184028112 AGAGATTAGAAGTGGGGAGAAGG - Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986400750 5:7377108-7377130 AGTGATTAGGAGATGGGAGAAGG - Intergenic
986890070 5:12292557-12292579 AATCATTAGGAGAGGGGAAAAGG - Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
987339844 5:16930088-16930110 ACTCATTTGAAAAGGGGAGAGGG + Intronic
987596262 5:20003552-20003574 ATTTGTTAGTAGAGGAGAAAAGG - Intronic
988208610 5:28173171-28173193 ATTTTTTAGAAGAGCTGTGATGG - Intergenic
988463738 5:31467200-31467222 ATATATTAGAAGAGGCTAAAGGG - Intronic
990020223 5:51117371-51117393 ATTTAATAGCACAGGGAAGATGG - Intergenic
991367747 5:65886776-65886798 ATTTATTAGGAAAGAAGAGAAGG + Intergenic
991592685 5:68270556-68270578 ATTTATGAGAAAAGGGGAAGAGG + Intronic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
992093208 5:73338033-73338055 AGTGATTAGGAGAAGGGAGAGGG - Intergenic
992681105 5:79153997-79154019 ATTTCTTAGGAGTGGGAAGATGG - Intronic
995832159 5:116365102-116365124 ATTTATCAGAAGAGACCAGATGG + Intronic
995878727 5:116820239-116820261 AATGATTAGAAGAAGGTAGATGG + Intergenic
995963392 5:117873132-117873154 ATTTTCTAGAAAAGGGGCGAGGG + Intergenic
996379245 5:122846601-122846623 AATATTTAGAGGAGGGGAGAGGG - Intronic
996602576 5:125282412-125282434 ATTTTTTAAAATAGGAGAGAAGG - Intergenic
998152438 5:139765021-139765043 ATCTATGAGAAGTGGGGACATGG - Intergenic
998214926 5:140230420-140230442 TTTTATTAGAAAAGGTTAGAGGG + Intronic
998756785 5:145390280-145390302 ATTTATTAGAAGAGTGAGAATGG - Intergenic
999448515 5:151660625-151660647 ATTGATTTGAAGTGGGGAGAAGG + Intergenic
1000781519 5:165488318-165488340 ACTTATTGCAGGAGGGGAGAGGG - Intergenic
1001154715 5:169263038-169263060 CCTTATTAGAAGAGGAGACAGGG + Intronic
1002158172 5:177299307-177299329 CTTTGTTAAAAGTGGGGAGAAGG + Exonic
1003406977 6:5833947-5833969 AATTTTTGGAAGAGGGGAGGGGG + Intergenic
1003691056 6:8354133-8354155 ACATTTTAGGAGAGGGGAGAGGG + Intergenic
1004638991 6:17495868-17495890 AGTTGTTAGAAGTGGGGACAGGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004928271 6:20436655-20436677 ATTTAAGAGAGGAGGGGAAAAGG - Intronic
1005956225 6:30665325-30665347 AGTAATGGGAAGAGGGGAGAGGG - Intronic
1007369532 6:41417275-41417297 ATTTGTTGGAAGAGGGAAGGAGG + Intergenic
1008391810 6:50960584-50960606 ATTTATTTGAAAGGGGAAGAGGG + Intergenic
1008526387 6:52411622-52411644 ATTTATCAGGGGTGGGGAGATGG - Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1009539693 6:64938107-64938129 ATTTATTTCAAGGGGGAAGAAGG + Intronic
1011401424 6:86966186-86966208 ATTACTAAGAAGAGGGAAGAAGG + Intronic
1012426770 6:99123685-99123707 ATTTTTTAAAAGAGAGGAAATGG + Intergenic
1012980955 6:105830555-105830577 ATTTATTAGAGGTGGGGGGTAGG + Intergenic
1013524699 6:110963433-110963455 TTTTAATTAAAGAGGGGAGAGGG - Intronic
1013904681 6:115200738-115200760 ATTTATAAGAACAGGGAAAAGGG + Intergenic
1014016090 6:116531800-116531822 ATTTATTATATGAGTGTAGAAGG - Intronic
1014229536 6:118887934-118887956 ATTTTTTAAAAAAGGGGTGAAGG + Intronic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016327703 6:142921832-142921854 ATTTTTTGGAAGTGTGGAGAAGG - Intronic
1017587074 6:155938242-155938264 ATTTGCTAAAAGAGGGGAAAAGG + Intergenic
1020313352 7:6886525-6886547 ATTCACTAGAAGAGGGGGGCAGG - Intergenic
1020513352 7:9087383-9087405 ACTTATTAGAACAGTGGTGATGG - Intergenic
1021392385 7:20109332-20109354 ATTTTTAAGAAGAGAGGAAAGGG + Intergenic
1022301298 7:29105166-29105188 ATTTCTTAGAGAAGGGGACATGG - Intronic
1022365563 7:29711890-29711912 AATCATTACAAGAAGGGAGATGG + Intergenic
1023149512 7:37188173-37188195 ATTTATTTGCAGAGTGGTGATGG - Intronic
1023531739 7:41163956-41163978 AATTGTTTGAAGAGGGTAGAGGG + Intergenic
1024127703 7:46317558-46317580 CATTCTTAGAAGAGGCGAGAGGG - Intergenic
1025603773 7:63024156-63024178 ATTTATAAGAAGAGGAGATTAGG + Intergenic
1027026573 7:74856553-74856575 ATTAAGCAGAAGAGAGGAGAAGG + Intergenic
1027061182 7:75087561-75087583 ATTAAGCAGAAGAGAGGAGAAGG - Intergenic
1027421617 7:78022395-78022417 ACTTCTTAGATAAGGGGAGAAGG + Intronic
1029063324 7:97822480-97822502 ATCTATTGGGAGAGGTGAGAAGG - Intergenic
1029190430 7:98767882-98767904 ATTTTTTGGAGGAGGGGAGGTGG - Intergenic
1030740719 7:113106278-113106300 AATTACCAGAAGTGGGGAGAAGG - Intergenic
1031301631 7:120068209-120068231 ATCTATTAGAACAGTGCAGAAGG + Intergenic
1032480252 7:132240383-132240405 ATTATTCAGAAGAGGGAAGAAGG - Intronic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033409491 7:141104391-141104413 ATATATTAGAAGATGTGAGGAGG + Intronic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1035745436 8:1959271-1959293 ATTTGGTAGAAAAGGGGAGGGGG + Intergenic
1036426468 8:8649489-8649511 ACTTATCAGAAAAGGTGAGAAGG - Intergenic
1036602162 8:10271355-10271377 GTTTTTTAAAAAAGGGGAGAGGG + Intronic
1036922841 8:12874293-12874315 CCTTATTACAAGTGGGGAGAAGG + Intergenic
1037081034 8:14786915-14786937 ATAAATTAGAGGAGGGGAAAGGG + Intronic
1037505961 8:19529537-19529559 ATTTATTAGTAATGGGGAAAGGG - Intronic
1038016794 8:23522465-23522487 CTTTATAAGAAGAGAGGAGTTGG + Intergenic
1038719434 8:30020483-30020505 ATTTATGAGAAGAGATGGGATGG - Intergenic
1039348659 8:36736043-36736065 ATTCATTAGAAAAGAGGAAAAGG - Intergenic
1039594097 8:38775550-38775572 ATTTGGCAGAAGAAGGGAGAGGG + Intronic
1039785732 8:40832816-40832838 ATTTATTAAAACAAAGGAGAGGG + Intronic
1040366822 8:46726007-46726029 ATCTATTGGGAGAGGTGAGAAGG + Intergenic
1042378463 8:68082968-68082990 ATATAACAGAAGAGGGGAGTAGG + Intronic
1042808019 8:72792975-72792997 TTTGGTTTGAAGAGGGGAGAGGG - Intronic
1043137231 8:76543611-76543633 AGTAATTAGAAGAAGGGAGATGG - Intergenic
1043943609 8:86225155-86225177 ATTTATTAGTAAAGGGGATTTGG - Intronic
1044802529 8:95972026-95972048 ATTTATTAGGAGCTGGGAGAAGG + Intergenic
1046009880 8:108533447-108533469 ATATATTGGAAGAGGGGGAAAGG - Intergenic
1046473692 8:114712810-114712832 ATTTATTAGAAGAGGACAGAGGG - Intergenic
1048407695 8:134139882-134139904 ATTTACTGGAAGAGATGAGAAGG - Intergenic
1048409060 8:134152773-134152795 ATTTCTTAGAAGATGTCAGAGGG - Intergenic
1049498186 8:142946529-142946551 CTTTATTAGAAGAGGAGATGAGG - Intergenic
1050138199 9:2490442-2490464 ATTTATTAGAAAAGGGGTCCAGG + Intergenic
1052228825 9:26122349-26122371 AATTATGAGAAGAGAAGAGAAGG + Intergenic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1053327737 9:37171241-37171263 AGTTGTTAGAAGTGGGGTGAAGG + Intronic
1053446488 9:38157148-38157170 TTTTATAAGAAGGGGGCAGAAGG - Intergenic
1056600728 9:88044665-88044687 ATTGATTAGAACTGGTGAGAAGG + Intergenic
1058066708 9:100556505-100556527 ATTGGTTAATAGAGGGGAGAGGG + Intronic
1058548160 9:106083307-106083329 ATTTACTAGAAGTGGGGTAAAGG + Intergenic
1058757512 9:108096931-108096953 ATCTACTAGAAGAGGCCAGATGG - Intergenic
1060293812 9:122329622-122329644 ACTTATTGGATGAGGGGAGAGGG - Intergenic
1062140406 9:134954490-134954512 GTTGAATAGAAGTGGGGAGAAGG + Intergenic
1185895132 X:3851670-3851692 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185900250 X:3890095-3890117 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185905366 X:3928526-3928548 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185983009 X:4799905-4799927 AGATTTTAGAAGAGGAGAGAAGG + Intergenic
1186135907 X:6520655-6520677 ATTAAGTAGAAGAAGGCAGATGG + Intergenic
1186818323 X:13260010-13260032 ATTGAATGGAAGAGGAGAGAAGG - Intergenic
1187355931 X:18571647-18571669 AATTATCAGATGAGGGGAGAAGG - Intronic
1188264200 X:28050525-28050547 ATTATTTAGAAGTGGGGAAATGG + Intergenic
1188853436 X:35161249-35161271 ATTTCTTAGAAAAGGGAAGGAGG - Intergenic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1192047094 X:67687146-67687168 ACTTAAGAGGAGAGGGGAGAGGG - Intronic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193276930 X:79600466-79600488 AATTATTAGAAGAAGAAAGAAGG - Intergenic
1193726527 X:85046379-85046401 ATTTATTAGGAAATGGAAGATGG + Intronic
1194497916 X:94639785-94639807 TTTTTTTAAAAGATGGGAGAAGG + Intergenic
1195681075 X:107547106-107547128 ATTGATGAGCAGAGGGGAAAAGG + Intronic
1197589756 X:128393921-128393943 ATATATTAGAGGAAGTGAGAAGG + Intergenic
1198379378 X:136069739-136069761 AATTATTAGCACTGGGGAGAAGG - Intergenic
1198767835 X:140096279-140096301 ATTTATTAAATGAGTGGAGGAGG + Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic
1199903228 X:152198580-152198602 AGTGATTACAAGAGGGAAGAAGG - Intronic
1200298998 X:154953327-154953349 CTTTATTAGAAGAGGAGATTAGG + Intronic