ID: 1193149900

View in Genome Browser
Species Human (GRCh38)
Location X:78114063-78114085
Sequence CCCAGCAGCTGGGTTGGCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 2, 1: 1, 2: 4, 3: 33, 4: 385}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193149900_1193149914 30 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149914 X:78114116-78114138 CATGTGGAGGAAGAAGGGAAGGG 0: 2
1: 1
2: 11
3: 83
4: 894
1193149900_1193149911 24 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149911 X:78114110-78114132 CGCTTTCATGTGGAGGAAGAAGG 0: 3
1: 0
2: 2
3: 12
4: 157
1193149900_1193149913 29 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149913 X:78114115-78114137 TCATGTGGAGGAAGAAGGGAAGG 0: 2
1: 1
2: 11
3: 89
4: 676
1193149900_1193149905 -7 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149905 X:78114079-78114101 TGCTGGGTCTGTCATCCTGCTGG 0: 3
1: 0
2: 0
3: 23
4: 192
1193149900_1193149907 14 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149907 X:78114100-78114122 GGAGAACCTCCGCTTTCATGTGG 0: 2
1: 2
2: 0
3: 5
4: 77
1193149900_1193149908 17 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149908 X:78114103-78114125 GAACCTCCGCTTTCATGTGGAGG 0: 2
1: 1
2: 1
3: 3
4: 50
1193149900_1193149912 25 Left 1193149900 X:78114063-78114085 CCTGTGCCAACCCAGCTGCTGGG 0: 2
1: 1
2: 4
3: 33
4: 385
Right 1193149912 X:78114111-78114133 GCTTTCATGTGGAGGAAGAAGGG 0: 2
1: 0
2: 1
3: 36
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193149900 Original CRISPR CCCAGCAGCTGGGTTGGCAC AGG (reversed) Exonic
900371290 1:2333310-2333332 CCCAGCAGCCGGGTCAGCCCCGG + Intronic
900758044 1:4451179-4451201 CACAGCAGCTGGGAGGGCAGGGG - Intergenic
901090196 1:6635786-6635808 ACCAGCAGCTGGCTGGGCCCAGG + Intronic
901218396 1:7567566-7567588 CCAGGAAGCTGGGCTGGCACAGG - Intronic
901377332 1:8848773-8848795 CCCAGCATCTGCGGTGACACAGG + Intergenic
901797927 1:11691436-11691458 CCCAGCAGCCGTGCGGGCACCGG - Exonic
902328121 1:15716067-15716089 CCCAGCTGCTGCTCTGGCACTGG - Intronic
902681250 1:18045420-18045442 ACCAGCAGCTGGATTTGCATAGG + Intergenic
902744093 1:18461658-18461680 GCCAGCAGCTGGGAGGCCACTGG - Intergenic
903229442 1:21913062-21913084 CCCAGCAACTCGATTGGCAGAGG + Intronic
903886786 1:26545613-26545635 CTCAGCAGCTGCATTGGCAGGGG + Intronic
904171590 1:28595141-28595163 CCCAGCTGCTGGAGTGCCACTGG + Exonic
904309977 1:29622604-29622626 CACTTCAGCTGGGTTGGCCCAGG + Intergenic
904827044 1:33280528-33280550 CCCAGCAGCGGGGCTGAAACAGG + Intronic
905386995 1:37611921-37611943 CCCGGCAGCAGTGTTGTCACAGG - Exonic
906293814 1:44636831-44636853 CCAAGGAGCTGGGAGGGCACTGG - Intronic
906476908 1:46175546-46175568 CCCAGAAGCTTGGTTTGCCCTGG - Exonic
906613289 1:47218309-47218331 CCCACCATCTGGATTGACACAGG + Exonic
906977303 1:50589279-50589301 GGCAGCAGCTGGGGTGGCTCTGG + Intronic
908137138 1:61144744-61144766 TCCAGCACCTGGCCTGGCACAGG + Intronic
908460838 1:64347197-64347219 CCCAGCGCCTGGGTAGGAACTGG + Intergenic
910404331 1:86870732-86870754 CCCAGCTGCTGGGTAGGCTGAGG - Intronic
911053522 1:93692264-93692286 CACAGCAGCTGTGTGTGCACTGG - Intronic
911803911 1:102180583-102180605 CCCAGCAGCTTGGGTGGCCAAGG - Intergenic
912450505 1:109765035-109765057 CCCAGCAGCTGGCTGTCCACTGG - Intronic
912839870 1:113029838-113029860 CCCAGCACTTGGGTAGGCAGAGG - Intergenic
913225897 1:116697906-116697928 CCCAGCAGCTGGTTTTGGCCTGG + Intronic
915156942 1:153884880-153884902 CCAAGCAGCTGGGATTACACGGG + Intronic
915228604 1:154429321-154429343 CCCAGCAGATGGGCTGGCATGGG + Exonic
915513421 1:156399665-156399687 CCAAGCAGGTGGGTTGGGGCGGG - Intergenic
916036654 1:160928354-160928376 CCCAGCAGTTTGGGTGGCAGAGG + Intergenic
919736831 1:200957861-200957883 CCCAGCATCTGGGTGGCCATCGG - Intergenic
919944900 1:202311945-202311967 CCCAGCAGCCTGGCTGGCTCTGG + Intronic
920280942 1:204843181-204843203 ACCAGCATCTGGGTAGGCCCTGG - Intronic
920373593 1:205494500-205494522 CCCAGCTGCTGGGGTGGCTGAGG - Intergenic
920564302 1:206961183-206961205 CCCAGCAGCTGGAGTGGCTGTGG + Exonic
921024122 1:211260880-211260902 CCCGCAAGCTGGGTTGGCAGAGG - Intronic
921320183 1:213931101-213931123 CCCAGCTGCAGGGGTGCCACTGG + Intergenic
922219457 1:223547160-223547182 CCCAGCACTTTGGGTGGCACTGG - Intronic
922569920 1:226628367-226628389 CACAGCAGCGGGGTTTGCCCCGG - Intergenic
922701650 1:227764653-227764675 CCCAGCAGTTGGGGAGGCAGAGG + Intronic
923163485 1:231337814-231337836 CCCAGGAGCTCGGTTGGCCTTGG - Exonic
923513563 1:234674503-234674525 GCCATCAGCTGGGTGGGGACTGG + Intergenic
924636726 1:245795202-245795224 ACCAGCAGGTGGCTTGGCTCAGG + Intronic
1063946141 10:11178195-11178217 CTCAGCAGCCCGGTTGGCAAAGG - Intronic
1067096897 10:43307476-43307498 CCCAGCAGCTGGGTCTGCGGGGG - Intergenic
1067793851 10:49306879-49306901 TCCAGCAGCTGGCCTGGCAGTGG + Intronic
1068411983 10:56667758-56667780 ACCAGCAGGTGAGTGGGCACTGG + Intergenic
1069190169 10:65477552-65477574 CCCAGCAGCTGGGGAGGCTGAGG + Intergenic
1069633281 10:69910499-69910521 CCCAGCAGCTGGACTGGGCCTGG + Intronic
1070183733 10:74039530-74039552 CCCAGCAGTTAGGTAGGCAAAGG + Intronic
1070682139 10:78456127-78456149 CCCGGCAGCTTGGTGGGCAGAGG + Intergenic
1071709350 10:88034136-88034158 CCCAGCAGCTGGAGAGGGACAGG + Intergenic
1072739721 10:97902088-97902110 GTCAGAAGCTGGGTGGGCACCGG + Intronic
1072861090 10:99006568-99006590 CCCAGAAGCTGGCCTGGCACTGG + Intronic
1073174106 10:101540776-101540798 CCCAGCAGATGGAGTGGCTCAGG - Intronic
1074988423 10:118679313-118679335 CCCAGCTGCTTGGGTGGCTCAGG - Exonic
1075567044 10:123512390-123512412 GCCAGGCGCTGGGTGGGCACTGG - Intergenic
1075682189 10:124341058-124341080 CTCAGGAGCGGGGCTGGCACTGG - Intergenic
1075712480 10:124538045-124538067 CCCAGCAGGTGGGTGGGCCTGGG - Intronic
1075728938 10:124624974-124624996 CCCAGCAGATGGGTGGGGACTGG + Intronic
1076381133 10:130025173-130025195 CCCAGCAGCATGGCTGGCGCGGG + Intergenic
1076704224 10:132292655-132292677 CAGAGCACCTGGGCTGGCACCGG - Intronic
1076716018 10:132364208-132364230 CCCAGCAGCAGGGTTTGTGCCGG - Intronic
1076731972 10:132443846-132443868 CCCAGCTGCTGGCTGGGCGCTGG - Intergenic
1076898810 10:133327054-133327076 CTCAGGGGCTGGGCTGGCACAGG + Intronic
1076946783 10:133657067-133657089 CCCAGAAGATGTGTTTGCACTGG - Intergenic
1077144056 11:1036985-1037007 CCCAGCAGCGGGGAGGGCCCGGG - Intergenic
1077200107 11:1302509-1302531 GCCAGCAGCTGAGTGGGCATGGG - Intronic
1077256984 11:1589900-1589922 CCCAGCAGCTGGGATGACAAAGG + Intergenic
1077367318 11:2166425-2166447 CCCAGGGGCTGGCTTGGCGCCGG - Intronic
1078370033 11:10736710-10736732 CCCAGCAGCTTGGTAGGCCGAGG + Intergenic
1078535597 11:12170891-12170913 CCCAGCACAGGGCTTGGCACAGG + Intronic
1078930042 11:15905705-15905727 CCCAGGAGCTGGCTTGGCAGTGG + Intergenic
1079312022 11:19375335-19375357 CCCAGAAGATGGCTGGGCACAGG + Intronic
1079608632 11:22402157-22402179 CCCAGCAGCTGGGGAGGCTGAGG + Intergenic
1081717132 11:45258370-45258392 TCCAGCGGCAGGGTTGGTACTGG - Intronic
1082087797 11:48064399-48064421 CCGAACAGCTGGGCTGACACCGG + Intronic
1083395122 11:62385612-62385634 CCCAGCAGCTTGGGTGGCTGAGG + Intronic
1083407796 11:62470857-62470879 TTCAGCAGCTGGGTAAGCACTGG - Intronic
1084085553 11:66853480-66853502 CCCAGAAGCTGTGCTGGCCCAGG - Intronic
1084153929 11:67303592-67303614 GCGAGCACCTGGGCTGGCACCGG - Exonic
1084323287 11:68385303-68385325 GCCAGCAGCAGGCTTGGCCCTGG + Intronic
1084533821 11:69745493-69745515 GCCCGCACCTGGGTGGGCACGGG - Intergenic
1084591371 11:70092596-70092618 CCCAGCACCTGGGGTGGCTGAGG + Intronic
1084909098 11:72373135-72373157 GGCAGAAGCTGGGTTGGCATAGG - Intronic
1087009645 11:93501171-93501193 CCCAGCAGCAGAGTTGGCACTGG - Intronic
1087759601 11:102091626-102091648 CCCAGCACCTCGGGAGGCACAGG + Intergenic
1089273033 11:117315031-117315053 CCCACCATCTGGGCTGCCACTGG - Intronic
1089869733 11:121661447-121661469 CACATCAGCTGGGTTGTCAGTGG + Intergenic
1090979412 11:131704219-131704241 CACAGGAGCTGGCCTGGCACTGG - Intronic
1091176392 11:133562110-133562132 CCCAGTGCCTGGGTTGACACAGG - Intergenic
1091216676 11:133906569-133906591 GTCAGCACCTGGGTTAGCACGGG + Intergenic
1091771049 12:3151546-3151568 GCCACCAGCTGGGTGGGCACTGG + Intronic
1092218871 12:6700023-6700045 CCCAGGGACTGGGTTGGCGCTGG - Intronic
1093262096 12:16950849-16950871 CCAAGCAGCTGGGCTGGCCCAGG - Intergenic
1094455688 12:30630292-30630314 CCCAGCAGCAGGGTGAGCAGAGG + Exonic
1094505994 12:31061545-31061567 CCAAGCTGCTGGGTTTTCACTGG - Intergenic
1096842269 12:54386656-54386678 CCCAGCAGCTGGTTTTGGGCTGG + Intronic
1096874316 12:54615365-54615387 CCCATGAGCTGGGTTGGGAGTGG + Intergenic
1097957531 12:65501478-65501500 CTCAGCAGCAGGGTTGCCAAAGG - Intergenic
1098363643 12:69679743-69679765 CCCAGCTGCTGGGGAGGCTCAGG + Intronic
1098899316 12:76096812-76096834 CCCAGCAGCTTGGGAGGCTCAGG + Intergenic
1099363428 12:81736856-81736878 CCCAGCTGCTGGGGAGGCAGAGG - Intronic
1100632914 12:96406331-96406353 CCCAGCAGATTGGTTGGCCAAGG - Intergenic
1101042239 12:100768106-100768128 CTCTGGAGCTGGTTTGGCACTGG + Intronic
1101167418 12:102052673-102052695 CACAGGAGCTGACTTGGCACTGG - Intronic
1101582637 12:106056506-106056528 CCAAGCAGCTGGGATTACACGGG - Intergenic
1102848836 12:116218847-116218869 TCCAGCTGCTGGGGTGGCTCAGG - Intronic
1102970262 12:117160882-117160904 CCCAGCACTTGGGGTGGCAGAGG - Intronic
1104915202 12:132260843-132260865 CCTGGCCGCTGGGTTGGCCCCGG - Intronic
1106578538 13:30998567-30998589 CCGTGCAGCTGGGTTGCCATGGG + Intergenic
1106603128 13:31204263-31204285 CCCAGGGGCTGGTTTGGCAGAGG + Intronic
1109736123 13:66486325-66486347 CCCAGCTCCTGGGTTGGGAGTGG + Intronic
1111461700 13:88552871-88552893 CCCTTCAACTGGGTTTGCACAGG + Intergenic
1111828179 13:93295255-93295277 CACAGAAGCTGGGGTGGTACAGG + Intronic
1112001799 13:95217606-95217628 CCCAGTAGCTGGGATTGCAGGGG - Intronic
1112624526 13:101089011-101089033 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1114066733 14:19066326-19066348 CCCTGCAGCTGTGTTTGAACAGG + Intergenic
1114095533 14:19333701-19333723 CCCTGCAGCTGTGTTTGAACAGG - Intergenic
1114856279 14:26448412-26448434 TGCTGCTGCTGGGTTGGCACTGG + Exonic
1115104820 14:29747857-29747879 CCCAGCTGCTCGGTAGGCAGAGG - Intronic
1115648721 14:35387905-35387927 CCCAGCAGCTTGCTGGTCACTGG - Intergenic
1116608608 14:47036152-47036174 CCCAGCTGCTGGGGTGGCTGAGG + Intronic
1117572067 14:57057555-57057577 CCCAGCTCGTGGGTTGGAACTGG - Intergenic
1117650946 14:57904800-57904822 CCCAGCATCTGGGTTGGTGCTGG - Intronic
1118737375 14:68711686-68711708 CTCAGCAGCTGGGCTGGGACAGG - Intronic
1119531938 14:75368149-75368171 GTCAGCAATTGGGTTGGCACAGG - Intergenic
1119617981 14:76111451-76111473 AGCAGCAGCTAGGTTGGGACTGG - Intergenic
1119847080 14:77838646-77838668 CCCAGCAGCTTGGTAGGCCAAGG - Intronic
1120833889 14:89023149-89023171 CCCAGCACCTGGAATAGCACCGG - Intergenic
1121585755 14:95061854-95061876 CCCCACAGCTGGTTTGGCCCTGG - Intergenic
1121640716 14:95483158-95483180 GTGGGCAGCTGGGTTGGCACAGG - Intergenic
1121676333 14:95756168-95756190 CCCAGCAGCTGGAGTGGGACAGG + Intergenic
1122541222 14:102498614-102498636 CCGGGCAGCTGGTTTGGCCCAGG + Exonic
1122848748 14:104515282-104515304 GCCGGCAGCTGGGTAGGAACTGG + Intronic
1122979426 14:105185014-105185036 CCCAGCTGCTGGGTTGGCAGTGG - Intergenic
1125510455 15:40289838-40289860 CCATGCAGCTGGGGTGGCAGGGG - Intronic
1128699420 15:69793551-69793573 CCCGGCGGCTGGGTTGGCTGGGG + Intergenic
1129364116 15:75043908-75043930 CCCTGCGGATGGGTGGGCACTGG + Intronic
1130927885 15:88398681-88398703 CCCAGCACCTGGCCTTGCACTGG - Intergenic
1131831592 15:96358221-96358243 CCCAGCAGCTGCGAGGGCCCAGG - Intergenic
1132514052 16:358097-358119 ACCAACAGCTGGGATGGCCCAGG - Intergenic
1132578875 16:676160-676182 CCCAGGAGCTGGCAGGGCACTGG - Intronic
1133211365 16:4264937-4264959 CCCAGGGGCTGGGTGGGCAGGGG - Intronic
1133268585 16:4599568-4599590 CCCTGCAGCTGGGTGGACGCTGG - Intronic
1133667897 16:7987700-7987722 CCCAGCAACTGGGGAGGCAGGGG + Intergenic
1133682860 16:8136958-8136980 CCCAGCATGTTGGTTGGCCCAGG + Intergenic
1134310299 16:13070333-13070355 CCCAGTCTCTGTGTTGGCACAGG + Intronic
1134570331 16:15285102-15285124 CCCAGCAGCTGGGGGGACAGAGG + Intergenic
1134732045 16:16470951-16470973 CCCAGCAGCTGGGGGGACAGAGG - Intergenic
1134935396 16:18241012-18241034 CCCAGCAGCTGGGGGGACAGAGG + Intergenic
1135281093 16:21154151-21154173 CCCAGCAGCTGGGGAGGCCAAGG + Intronic
1135668420 16:24354783-24354805 CCCAGGGGCTGGCTGGGCACAGG + Intronic
1136382438 16:29901745-29901767 GGCAGTTGCTGGGTTGGCACCGG - Exonic
1136403684 16:30031340-30031362 AACAGCAGCTGCGGTGGCACAGG + Intronic
1137768548 16:50996437-50996459 CCCAGGAGCTGGGTTTTCGCAGG - Intergenic
1138516244 16:57536691-57536713 CCCAGCAGCTCGGTGGGCCGGGG - Intergenic
1138665605 16:58565226-58565248 CCCAGCAGCTGGGGAGGCTGAGG - Intronic
1139441726 16:66971363-66971385 CCCAGGAGCTGGGTCATCACAGG + Intronic
1139582691 16:67882741-67882763 CCCCGCAGCTGGGCTAGCACAGG - Exonic
1140219917 16:73036376-73036398 TCCAGCAGCCGGATTAGCACAGG + Intronic
1140418284 16:74793505-74793527 CCCAGCTACTGGGGAGGCACAGG + Intergenic
1141705192 16:85661008-85661030 CCCTGCAGCCCTGTTGGCACTGG + Intronic
1142126607 16:88413749-88413771 CCCAGGAGCTGGGATGTCCCTGG - Intergenic
1142227381 16:88884254-88884276 CCCAGCAGCAGGGTCAGCAGAGG - Intronic
1142671109 17:1487793-1487815 CCGAGCAGCTGGGATTACACAGG - Intronic
1142708949 17:1713239-1713261 CCCAGAAGCTGGGTGGGGAATGG - Intergenic
1144314990 17:14051285-14051307 CCCAGCAGCTTGGGAGGCTCAGG + Intergenic
1144630567 17:16870155-16870177 CCCAGCAGCTGGAGTGGGCCTGG - Intergenic
1144650758 17:17005300-17005322 CCCAGCAGCTGGAGTGGGCCTGG + Intergenic
1144739539 17:17573895-17573917 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1145852299 17:28112341-28112363 CCCAGCAGCTTCGTTGTCACAGG - Intronic
1146446659 17:32937547-32937569 CCCAGGCTCTGGGTGGGCACTGG + Intronic
1147753142 17:42749607-42749629 CCCTGCTTCTGGGTTGGAACTGG - Intergenic
1149237754 17:54612913-54612935 CACAGGAGCTGGTTTGGCAGTGG - Intergenic
1149539433 17:57457642-57457664 CCCAGCAGCTGGGGAGGCTGAGG + Intronic
1149589007 17:57813757-57813779 CCCAGCTACTGGGGTGGCAGAGG + Intergenic
1149916629 17:60615282-60615304 CCAAGCAGCTGGGTTTGCCTGGG - Intronic
1150226999 17:63529706-63529728 CCATGGAGCTGGGTTGGCCCTGG - Intronic
1151705592 17:75765299-75765321 CCCAGCAGCTGGATTCCCACGGG - Exonic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1151970373 17:77454574-77454596 ACCAGCAGCTGGGCAGGCACAGG - Intronic
1152391698 17:80007503-80007525 CCCAGCAGCTGGGGACGGACAGG + Intronic
1152733878 17:81987283-81987305 CCCAGGCGCTGTGTGGGCACTGG + Intronic
1153002698 18:470355-470377 CCAAGCAGCTGGGATGACAGGGG + Intronic
1153518906 18:5933582-5933604 CCCAGCTGCTCGGTTGGCTGAGG - Intergenic
1155087294 18:22470987-22471009 CCCAGAAGCTGGCTGGGAACTGG + Intergenic
1156477653 18:37416343-37416365 CCCAGGAGCTGGGTTCTGACAGG - Intronic
1157245950 18:46055434-46055456 CCCAGCTACTGGGGTGGCAGAGG - Intronic
1157830390 18:50851949-50851971 TCCAGCAGCTGAGTAGGCCCAGG - Intergenic
1158662588 18:59402080-59402102 CCAAGAAGCTGCGTTAGCACTGG - Intergenic
1158886179 18:61829414-61829436 CCCTGCAGCTGGGATGGGCCAGG + Intronic
1159906004 18:74092983-74093005 ACCCACAGCTGTGTTGGCACAGG + Intronic
1160693568 19:471556-471578 CCCAGCTGCTGGGGAGGCCCAGG - Intronic
1160802455 19:976710-976732 CCCAGGAGCTGGGTTCCCCCGGG - Intergenic
1161190137 19:2950107-2950129 CCCTGCACCTGGGTTGGAAATGG - Intergenic
1161218435 19:3106327-3106349 GGCAGCAGCTGAGTTGGCGCGGG + Intronic
1162289148 19:9765555-9765577 CCCAGCAGCTGGGGAGGCTGAGG + Intronic
1162706618 19:12559890-12559912 CCCAGCAGCTGGGTTGGTACAGG - Intronic
1163124993 19:15239814-15239836 CGCAGCTCCTGGGATGGCACAGG + Exonic
1163632719 19:18425410-18425432 CCTGGCAGGTGGGTTGGCACTGG + Intronic
1163991380 19:21002123-21002145 CCCAGCAGCTGGGGAGGCCAAGG + Intergenic
1164596377 19:29533183-29533205 CCTATCTGCTGGGATGGCACTGG - Intronic
1165229968 19:34380819-34380841 TGCTGCAGCTGGGTAGGCACTGG - Intronic
1165487891 19:36106388-36106410 CCCGGCACCTGGGTGGGAACTGG - Intergenic
1165731800 19:38150662-38150684 CCAAGTAGCTGGGATGTCACAGG + Intronic
1167036262 19:46996678-46996700 TCCAGCTGCTAGCTTGGCACAGG - Intronic
1167385494 19:49160712-49160734 CGCAGCAGTGGGGTTGGCTCTGG + Intronic
1167556909 19:50202565-50202587 CTCAGCAGCTGTGTGGGCTCAGG - Intronic
925104971 2:1283303-1283325 CCAAGCAGCCGGATTGGCAGGGG - Intronic
926430372 2:12779347-12779369 GCCAGCTGCTGGGTTGGCTGGGG + Intergenic
927643713 2:24861826-24861848 CCCAGCCCCTGGGGAGGCACCGG - Intronic
927718006 2:25364848-25364870 CCAGGCAGCTGGGTGGGCAGCGG + Intergenic
927753607 2:25691066-25691088 CCCAGCTGCTCGGGTGGCAGGGG + Intergenic
927787337 2:25982696-25982718 CGCAGGACCTGGGTCGGCACCGG - Intronic
927953677 2:27192344-27192366 CCCAGGAGCTGGGTCGGGAGCGG + Intergenic
927960978 2:27240580-27240602 CCCAGGAGCTGGGATCCCACGGG + Intronic
929933906 2:46279176-46279198 CCCAGCAGGTCTGTTGGCCCAGG - Intergenic
931444273 2:62313815-62313837 AGCAGCAGCTGCGTTGGCAAGGG + Intergenic
931447406 2:62338261-62338283 GCCAGCAGCTCAGCTGGCACTGG + Intergenic
932702673 2:74002302-74002324 GGCAGCAGCTGGGACGGCACCGG - Intronic
934709175 2:96503861-96503883 CCCAGTGGCTGGGCTGGCACAGG + Intronic
934744858 2:96752684-96752706 CCCAGCTGCTGGGGAGGCAGAGG - Intergenic
935293156 2:101626655-101626677 CCCAGCAGCTGGGGAGGCAGAGG - Intergenic
936088564 2:109486693-109486715 CCCAGCAGTGTGGTTGGCGCAGG + Intronic
936927970 2:117757402-117757424 CCCAGCACCTTAGTTTGCACAGG + Intergenic
937362997 2:121241990-121242012 CCATGAAGCTGGGATGGCACTGG + Intronic
937436994 2:121889034-121889056 CCCAGCTACTGGGTAGGCTCAGG + Intergenic
938457403 2:131475676-131475698 CCCAGGTGCTGGGTGGGAACAGG + Intronic
938841650 2:135170786-135170808 ACCAGAAGCTGAGTAGGCACTGG + Intronic
938985614 2:136572555-136572577 CCTGGCAGCAGAGTTGGCACTGG - Intergenic
939923076 2:148141020-148141042 CCCAGCAGTTTGGTTGGCTGAGG - Intronic
940856288 2:158730876-158730898 CCCAGGAGCCAGGTTGTCACTGG - Intergenic
940964539 2:159822401-159822423 CCCAGCAGCTTTGTTTACACTGG - Intronic
941666780 2:168250225-168250247 GTCAGCAGCAGGGTTGCCACTGG - Intergenic
942251013 2:174047855-174047877 CTCAGCACCAGGGCTGGCACAGG - Intergenic
943725159 2:191245409-191245431 CTCCGCAGCTGGGTGCGCACGGG + Exonic
944241748 2:197492438-197492460 CCCAGCACTTGGGGAGGCACAGG - Intronic
946446614 2:219745595-219745617 TCCAGCAGTTGGGTTGGGAAAGG + Intergenic
946869446 2:224072628-224072650 CCCAGCAGCTGGGAGGACTCTGG + Intergenic
946891693 2:224283443-224283465 CCCCGCAGCAGGGGTGGAACAGG - Intergenic
947088735 2:226485775-226485797 CCCAGCAGATGGGGTGACATGGG - Intergenic
947864640 2:233387925-233387947 CACAGCAGCTGGGAGGACACTGG - Intronic
947909014 2:233789658-233789680 CCCAGCTCCTGGGCTGGCAGAGG - Intronic
948919567 2:241056364-241056386 CCCAGCAGCTTGGGAGGCAGAGG - Intronic
948974981 2:241458427-241458449 CTCAGCAGGTAGGATGGCACAGG + Intronic
948980715 2:241493244-241493266 TCCAGGGGCTGGGTTGCCACAGG - Exonic
1168819565 20:763826-763848 CCCAGCACCTGGGTTGACGCTGG + Exonic
1168845071 20:938885-938907 TCCTGCAGCTGGGTGGCCACAGG + Intergenic
1170424298 20:16223341-16223363 CCCAGCTGCTGGGGAGGCTCAGG - Intergenic
1170940246 20:20842793-20842815 CTCAGCAGCTGGGTTTGAAGGGG - Intergenic
1172274170 20:33670785-33670807 CCCATCATCTGGGGTGGCAGGGG + Exonic
1173871097 20:46342667-46342689 CCCTGCAGTTGGGCTGGCCCAGG - Intergenic
1174414242 20:50356671-50356693 CGCAACAGCTGGGGTGGCTCAGG - Intergenic
1174781484 20:53393078-53393100 CCCAGCACCTGGGGAGGCAGAGG - Intronic
1175903705 20:62369874-62369896 CCCTGGAGCTGGGTGGGCAGGGG - Intergenic
1176082608 20:63281565-63281587 GCCAGCAGCTGGTCTGACACAGG - Intronic
1176086450 20:63297506-63297528 GCCAGCTGCTGTGTTGGCTCGGG + Intronic
1176326699 21:5507890-5507912 CCCAGAAGATGTGTTTGCACTGG - Intergenic
1176401058 21:6313061-6313083 CCCAGAAGATGTGTTTGCACTGG + Intergenic
1176436099 21:6676043-6676065 CCCAGAAGATGTGTTTGCACTGG - Intergenic
1176460361 21:7003113-7003135 CCCAGAAGATGTGTTTGCACTGG - Intergenic
1176483922 21:7384891-7384913 CCCAGAAGATGTGTTTGCACTGG - Intergenic
1178904765 21:36627317-36627339 CACATCATCTGGTTTGGCACTGG - Intergenic
1180485215 22:15788910-15788932 CCCTGCAGCTGTGTTTGAACAGG + Intergenic
1180730902 22:17981703-17981725 CACAGCAGGTGTGATGGCACAGG + Intronic
1181043420 22:20203595-20203617 CCCAGGAGCAGGGTTGGGGCAGG + Intergenic
1181349218 22:22243523-22243545 CTGAGCAGCTGGGTGTGCACTGG - Intergenic
1182078625 22:27512714-27512736 GCCAACATCTGGGTTTGCACTGG - Intergenic
1182567463 22:31211047-31211069 CCCAGCAGTTGGGTAAGCAAAGG - Intergenic
1182582889 22:31325714-31325736 CCCAGCACCTGGGGTGGGAGTGG - Intergenic
1183468156 22:37990493-37990515 CCCAGCAGCTGGAGAGGCTCAGG - Intronic
1183697021 22:39429222-39429244 CTCATCAGCTGGGTGGGGACGGG - Intronic
1184371943 22:44088205-44088227 TGCAGGAACTGGGTTGGCACTGG + Intronic
1184826732 22:46957641-46957663 GTCAGCAGATGGGTTGGAACTGG + Intronic
1184932370 22:47690803-47690825 CCCCGCTGCTGGGGTGACACTGG - Intergenic
1185041787 22:48507919-48507941 CCCAGCAGCTGGTGTGGGCCAGG - Intronic
949354451 3:3163443-3163465 CCATGCAACTGGGTTGCCACTGG - Intronic
949912050 3:8919398-8919420 TCCAGCAACTGGGTTGTCTCAGG - Intronic
950465518 3:13151041-13151063 CCCAGCAGCAGGACAGGCACAGG + Intergenic
950833483 3:15897997-15898019 CCCAGAAGCTGGGTTGGAAGTGG - Intergenic
950934848 3:16828479-16828501 CCCATCTGCTGGGTGGCCACTGG + Intronic
953365745 3:42343174-42343196 CCCAGCAGCTTGGGAGGCCCAGG + Intergenic
953884824 3:46709268-46709290 CCCAGGAGGTGAGTTGGCCCTGG + Exonic
954040449 3:47882920-47882942 CCCAGCTGCTCGGTTGGCTGAGG - Intronic
954130199 3:48556805-48556827 CCCGGCTGCTGGGTTGGAAGCGG - Exonic
955429807 3:58831092-58831114 CCCAGCAGAGGAGTTGGAACAGG - Intronic
956469048 3:69545968-69545990 CCCAGCAGCTGGGATTACAGGGG + Intergenic
957080667 3:75633349-75633371 CCCAGAAGATGTGTTTGCACTGG + Intergenic
959327575 3:104956809-104956831 CCCAGCTGCTGTGGTGGGACAGG + Intergenic
959378113 3:105609667-105609689 CCCAGCACCTTGGGTGGCCCAGG + Intergenic
961531138 3:127541161-127541183 CCCAGCTGCTGGCTTGGCTGTGG + Intergenic
963613109 3:147497385-147497407 CCCAACAGCTGGGTTGTAAAAGG + Intronic
963863082 3:150330722-150330744 CCAAGCAGCTGTGTTGGGGCAGG - Intergenic
964647580 3:158974513-158974535 CCCATGAGTTGGGTTGGCTCTGG - Intronic
965372202 3:167877227-167877249 CCAGGCAGCTTGCTTGGCACTGG + Intergenic
966254265 3:177899503-177899525 CCCAGCTCCTGGGCTGGCCCAGG - Intergenic
966289970 3:178343826-178343848 CAATGCAGCTGGGTTGGCAGGGG - Intergenic
966603332 3:181796837-181796859 CCCAGCACCTGGGGAGGCAGAGG + Intergenic
966832001 3:184017779-184017801 CCCTCCAGCTCGGTTGTCACGGG - Intronic
968166208 3:196467272-196467294 CCCAGCTGCTGGGGAGGCTCAGG - Intergenic
968509326 4:988427-988449 CCTACCAGCAGGGTGGGCACCGG + Exonic
968548842 4:1212372-1212394 CACAGCAGCTGGGATGCCAGTGG + Exonic
968644286 4:1731229-1731251 CCCTGCTGATGGGTGGGCACTGG - Exonic
968782737 4:2595297-2595319 CCCAGCACCTGGGGAGGCAGAGG - Intronic
968874453 4:3258022-3258044 CCCAGCATCTAGGGTGGCACAGG - Intronic
968905728 4:3449738-3449760 CTCAGCACCTGGGTTGTCCCAGG + Intergenic
968980676 4:3847793-3847815 GCCAGCACCTGTGTTGGCACTGG - Intergenic
969100928 4:4767810-4767832 CCCAGCACCTTGGTTGGCTGAGG + Intergenic
969318168 4:6394727-6394749 CCCAGCACCTGGGGTCCCACAGG + Intronic
969626721 4:8309377-8309399 CCCAGCAGCTGGGGCTGCACAGG - Intergenic
969675838 4:8613901-8613923 GCCAGCAGCTGGGATGCCAGGGG + Intronic
970601095 4:17641746-17641768 CCCAGCACTTTGGTTGGCAGAGG - Intronic
974276495 4:59727107-59727129 CCAAGCATCTGGCATGGCACAGG - Intergenic
974691780 4:65305911-65305933 CCCAGCAGCAGCATGGGCACAGG - Intergenic
975636797 4:76458041-76458063 CCCAGCACCTGGGGAGGCCCAGG - Intronic
975848941 4:78552004-78552026 CCACGCAGCTGGGTTGGGGCCGG - Intronic
980120402 4:128722072-128722094 CGCAGCAGCTGGGATGGAAGAGG + Intergenic
984177382 4:176436359-176436381 TCTAGCAGCTGGGATGGCTCAGG + Intergenic
984497302 4:180514988-180515010 CCTAGCAGTTTGGTAGGCACAGG + Intergenic
985069944 4:186158175-186158197 GCCAGCAGCTGGAGTGGCTCTGG - Intronic
985450238 4:190057866-190057888 CCCAGAAGATGTGTTTGCACTGG - Intergenic
985658784 5:1145318-1145340 CCCAGCAGCTGTGTCCCCACAGG - Intergenic
986024514 5:3838083-3838105 AACAACAGCTGGGTTGGCAGCGG + Intergenic
987263616 5:16228838-16228860 CCCAGCAGAAGGGTTGGGACAGG + Intergenic
991587449 5:68215449-68215471 CCCAGCAGCCGGGCGGGCCCGGG + Intergenic
991665346 5:68993971-68993993 CCAAGCAGCTGGGATGCCACAGG + Intergenic
993238990 5:85355164-85355186 CCCAGCTACTGGGTAGGCAGAGG - Intergenic
996653664 5:125913677-125913699 GACACCAGCTGGGGTGGCACAGG - Intergenic
997626542 5:135335163-135335185 CTCAGCAACTGGGATGCCACGGG + Intronic
998119117 5:139561615-139561637 CCCAGGAGCTGAGTGGGCCCCGG + Exonic
999144909 5:149385932-149385954 CCCAGCAGCTGCGTAGGGAGAGG + Intronic
1000628075 5:163562324-163562346 CCCAGCAGCTGGGCTGACAAGGG - Intergenic
1001405606 5:171474870-171474892 CCTGGCAGCTGGGTGGGCATTGG - Intergenic
1002147398 5:177195581-177195603 CCCAGCTGCTTGGAAGGCACAGG - Intronic
1002881188 6:1254077-1254099 ACCAGCAGCCAGATTGGCACAGG + Intergenic
1003610794 6:7613313-7613335 CCCAGCAGCTGGGGAGGCTGAGG + Intergenic
1005527134 6:26661957-26661979 CCCAGCTGCTTGGTAGGCATAGG + Intergenic
1007476714 6:42124164-42124186 CCCAGCAGCAGAGCTGGGACTGG + Intronic
1008296700 6:49786846-49786868 ACCAGGAGCTGGGTTGGCACAGG + Exonic
1008817078 6:55580529-55580551 CCCAGCAGCTGGGGAGGCCGAGG - Intergenic
1010080235 6:71853116-71853138 TCCAGAAGCTGGGTTTGCTCAGG - Intergenic
1010926598 6:81752596-81752618 CACCGCAGCTGGGGTGGCAGCGG - Exonic
1011648528 6:89483526-89483548 CTCTGCAGCTGGGATGGCCCAGG - Intronic
1011697934 6:89929806-89929828 CCAAGAAGCTGGGTTGGACCTGG + Exonic
1013180337 6:107712012-107712034 CCCATAAGGTGGTTTGGCACGGG + Intronic
1013419733 6:109956160-109956182 CCCAACAGATGTGTAGGCACTGG + Intergenic
1013734506 6:113209616-113209638 CCCAGCATCTGGGCTGTCTCAGG + Intergenic
1014552409 6:122804101-122804123 CCCAGCAACTGGGGAGGCAGAGG - Intronic
1015025856 6:128531737-128531759 ATCAGCAGCTGGGTTGCTACTGG - Intergenic
1015833012 6:137389881-137389903 CCCACCAGCTGGGTGGGCTAGGG - Intergenic
1016638691 6:146324171-146324193 CCCAGCAGCTTTGTTTACACTGG + Intronic
1017944321 6:159081183-159081205 CCCAGCTGCTGGGGTGGCTGAGG + Intergenic
1018544427 6:164919310-164919332 CTCAGGAGCTGGCTTGGCACCGG + Intergenic
1019299135 7:294812-294834 CCCAGCACAGGGCTTGGCACAGG - Intergenic
1020200734 7:6077800-6077822 CCCAGCAACTTGGTTGGCTGAGG - Intergenic
1020822923 7:12992648-12992670 AACAACAGCTGGGTTGGAACTGG - Intergenic
1021810226 7:24395763-24395785 CCCAGCTGCAGGGGTGGCCCTGG - Intergenic
1022530694 7:31065181-31065203 CACAGGAGCTGGGATAGCACTGG + Intronic
1023425934 7:40036046-40036068 CCCAGCTGCTGGGGTGGCTGAGG + Intronic
1023696297 7:42851149-42851171 CCCAGCACCTTGGGTGGCAGAGG + Intergenic
1027173341 7:75888204-75888226 CGCAGAAGCTGGGTAGACACTGG - Exonic
1027470256 7:78564907-78564929 CCCAGCAGCTCGGGAGGCTCAGG - Intronic
1027710825 7:81599469-81599491 CCCAGTAGCTGGGATTACACAGG + Intergenic
1030134302 7:106231887-106231909 ACTAGCAGCTTGGTGGGCACTGG + Intergenic
1030528270 7:110679623-110679645 CACAGCAGCGGGATTGGCAGTGG - Intronic
1031500546 7:122509329-122509351 CATATCAGCTGAGTTGGCACGGG - Intronic
1031711532 7:125052963-125052985 CCCAGCTGCTGGGGAGGCAGAGG - Intergenic
1032012643 7:128356904-128356926 TCTAGCAACTGAGTTGGCACAGG + Intronic
1032226285 7:130034367-130034389 CCCAGCTACTGGGTTGGCTGAGG + Intronic
1032566468 7:132952136-132952158 CCCAGTAGTTGGGTTGGCTTTGG - Intronic
1033265232 7:139879997-139880019 CCCAGCAACTTGGTTGGCTGAGG - Intronic
1034265841 7:149780281-149780303 CCTCGCAGCTGGGTGGGCAGAGG - Intergenic
1034439327 7:151078634-151078656 CCCAGCACCTGGCCCGGCACCGG - Exonic
1034781769 7:153887883-153887905 CCCTGCCGCTGGGTGGGCTCGGG - Intronic
1034840080 7:154387491-154387513 CCCAGCAGGTGGGTGGGCCCAGG + Intronic
1036464596 8:8984788-8984810 CCCAGCTACTGGGGAGGCACAGG + Intergenic
1038860326 8:31380852-31380874 CCCTTCACCTGGGTTTGCACAGG + Intergenic
1039288970 8:36073379-36073401 CCCAGCAGTTTGGTTGGCCAAGG + Intergenic
1045685158 8:104703984-104704006 GGCAGGAGCTGGGTTGGCCCTGG + Intronic
1049023495 8:139973282-139973304 CCCAGCAGCAGGGTGGCCACGGG + Intronic
1049645904 8:143735509-143735531 CCAAGCTGCTGGGTTGCCAGTGG - Intergenic
1049766951 8:144359318-144359340 ACCAGCAGGTGGGTCAGCACCGG - Exonic
1050311086 9:4353941-4353963 CCCAGCTGCTGGGTAGGCTGAGG - Intergenic
1050552631 9:6761123-6761145 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1050819883 9:9864802-9864824 CACAGAAGCTGGGTTGGGGCTGG - Intronic
1052471353 9:28900187-28900209 CCCAGCAGCTGGCTGGCCACTGG + Intergenic
1054356331 9:64066966-64066988 GCCAGCAGACCGGTTGGCACGGG + Intergenic
1055659821 9:78491673-78491695 CCCAGCAGCTGGGGTGGTGGTGG - Intergenic
1055962933 9:81837339-81837361 CCCAGCAGTTTGGGTGGCTCAGG + Intergenic
1055992063 9:82117102-82117124 ACCAGCAGCTGCCTTGGCACAGG - Intergenic
1056076240 9:83043938-83043960 CCCAGCAGCTCAGCGGGCACTGG - Intronic
1056639877 9:88361331-88361353 CCCAGCTGCTGGGTAGGCTGAGG - Intergenic
1057194858 9:93111295-93111317 CCCAGCAGCTCTGTGGGCCCAGG - Intronic
1059391695 9:114003183-114003205 CCCAGCACCTGGGGCGGCACAGG + Intronic
1060172223 9:121471213-121471235 CTCAGCTGCTGGGTGGGCAGGGG - Intergenic
1060295043 9:122337628-122337650 CCTGGCAGCTGGGCTGGCAGGGG + Intergenic
1060521579 9:124297026-124297048 CACAGCAGCTGGCTTTGCAGAGG + Intronic
1061512574 9:131069984-131070006 GCCTGAAGCTGGGTGGGCACAGG - Intronic
1062047102 9:134429406-134429428 CCCAGAGGCAGGGCTGGCACAGG - Intronic
1062391058 9:136334031-136334053 CCCAGCAGCTGTGGTCGCTCAGG + Intronic
1062444786 9:136589032-136589054 CCCAGCAGCTGGGCTCCCTCGGG - Intergenic
1185737451 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG + Intergenic
1185801712 X:3017139-3017161 CCAAGCAAATGGGTTGGGACGGG - Intronic
1186668014 X:11738657-11738679 CCCAGCTGCTGGGGTGGCTGAGG - Intergenic
1186872699 X:13788175-13788197 CCCAGGAGCTGGGTTCTAACTGG + Intronic
1190219695 X:48503886-48503908 GCCAACAGCTGGGTAGGAACTGG + Intergenic
1191225700 X:58040610-58040632 CCCAGCAGCAGTGTTGGTGCAGG - Intergenic
1191731897 X:64345148-64345170 CCCAGCTGCTCGGTTGGCCATGG + Exonic
1192083542 X:68071427-68071449 CCCAGCAGCTGGGTTGGCACAGG + Intronic
1193149900 X:78114063-78114085 CCCAGCAGCTGGGTTGGCACAGG - Exonic
1195548428 X:106139017-106139039 TCCACCAGCAGTGTTGGCACGGG - Intergenic
1195750145 X:108156359-108156381 GCCAGCAGCTGGGTTGGGGGTGG - Exonic
1197353869 X:125410386-125410408 CCCAGCAGCTTGGCAGGCACTGG - Intergenic
1198891582 X:141403067-141403089 TCCAGCAGCAGTGTTGGCACAGG + Intergenic
1199080306 X:143569270-143569292 CCCAGGAGCTGGGGTGGCACCGG + Intergenic
1199599418 X:149533120-149533142 CCCAGCATCTGCCTTGGCATAGG - Exonic
1199651215 X:149947087-149947109 CCCAGCATCTGCCTTGGCATAGG + Intergenic
1199673189 X:150163593-150163615 ACCTGCAGATGGGTTTGCACAGG + Intergenic
1201277110 Y:12309545-12309567 CCCAGCAGTTGGGGAGGCAGAGG + Intergenic
1201279654 Y:12330840-12330862 CCCAGCTGCTCGGTAGGCTCAGG - Intergenic
1201713462 Y:17017419-17017441 CCCAGCAGTTTGGTAGGCAGAGG - Intergenic
1201772570 Y:17630171-17630193 CCCAGCAGCTGGGGAGGCTGAGG + Intergenic
1201828985 Y:18275816-18275838 CCCAGCAGCTGGGGAGGCTGAGG - Intergenic