ID: 1193151279

View in Genome Browser
Species Human (GRCh38)
Location X:78127182-78127204
Sequence TCTTAGAGATTTTGCCTCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193151279 Original CRISPR TCTTAGAGATTTTGCCTCCC AGG (reversed) Exonic
905952421 1:41963339-41963361 TCGGAGTGATTTTGCCTCCAGGG - Intronic
907034420 1:51203836-51203858 TCATAGTGATTGTGCCTACCAGG - Intergenic
909161826 1:72161399-72161421 CCATGGAGATTTTGCCCCCCAGG + Intronic
910530131 1:88226470-88226492 TGAAAGAGATTTTGTCTCCCAGG - Intergenic
910651922 1:89578021-89578043 TCTTAGAGGTTTTGTCACCTTGG + Intronic
912893872 1:113564154-113564176 TCTTAGAGGTTCTGTCTCCTGGG - Intronic
916418647 1:164615875-164615897 ACTTTGGGATTTGGCCTCCCTGG + Intronic
917877081 1:179295712-179295734 TTTTTGAAACTTTGCCTCCCAGG + Intronic
920590050 1:207208667-207208689 GCTGAGAGATTTTGTCTCTCAGG + Intergenic
921222700 1:212984644-212984666 TCTTACATATGTTGCCTTCCTGG - Intronic
921378767 1:214502169-214502191 TCATAAAGATTTTTCATCCCTGG + Intronic
922721847 1:227903595-227903617 TCTTAGGGATGTGGCCCCCCTGG + Intergenic
923053101 1:230402634-230402656 TTGTAGAGATTTTGCTGCCCAGG + Intronic
923748865 1:236728057-236728079 CCTTAGAGATTTTACATTCCTGG + Intronic
923929031 1:238672320-238672342 CCTTAGTGATTTGGCATCCCGGG - Intergenic
924568236 1:245215428-245215450 TCTCAGAGCTGTGGCCTCCCTGG - Intronic
924903096 1:248423149-248423171 TCTTAGAGGATTTGCTTCCCAGG + Intergenic
1064369167 10:14736107-14736129 TTTTAGAGACTTTGCCACACAGG - Intronic
1064664596 10:17637999-17638021 TTTTTCAGATTTTGCTTCCCTGG + Intergenic
1066189146 10:33039762-33039784 TCTTTGAGAGTTTGTGTCCCCGG + Intergenic
1067357933 10:45548505-45548527 TCTGAAAGATTTTGCATCTCAGG + Intronic
1070527039 10:77304323-77304345 TCTTAGAGATTCTGAGTTCCAGG + Intronic
1071908917 10:90208168-90208190 TCTTAAAGATTTTGGCTTCTAGG + Intergenic
1074490991 10:113939418-113939440 TGATAGAGATTTTTCCTTCCTGG + Intergenic
1076276004 10:129199427-129199449 TCTGAGACATTTTTCCTCCAAGG - Intergenic
1077995046 11:7445746-7445768 TATTAGAAAAATTGCCTCCCTGG - Intronic
1079225796 11:18603692-18603714 GCTTAGGCATTTGGCCTCCCAGG - Intergenic
1084903492 11:72327973-72327995 CCATACAGAGTTTGCCTCCCTGG - Intronic
1091568877 12:1667353-1667375 TCTTAGTGTTTTTTCCTGCCTGG - Intergenic
1092437073 12:8457835-8457857 TCCTGGGGATTTTGGCTCCCTGG + Intronic
1094526903 12:31237198-31237220 TTTTAGAGATTCTGCTTTCCTGG - Intergenic
1094715064 12:33005590-33005612 GCTTGGAGATCTTTCCTCCCAGG - Intergenic
1095859804 12:46904486-46904508 TGTTAGAGGTTTTGCCTGCAGGG + Intergenic
1097162243 12:57055425-57055447 CCTTAGAGATTTTGCATCCTGGG + Intergenic
1105320074 13:19311016-19311038 TTTTAGAGATTTCACCTCCTTGG + Intergenic
1111393687 13:87634276-87634298 TTTTAGAGACCTTGCCTCCCTGG - Intergenic
1112320156 13:98399057-98399079 TCATAGAGTTTTTCCCTCACTGG + Intronic
1114758632 14:25286626-25286648 ACTCAGGGATTCTGCCTCCCCGG - Intergenic
1114939145 14:27584821-27584843 TTTTACATATTTTGCCTCCAAGG - Intergenic
1116633994 14:47370226-47370248 TCTTAGAAAATTTGCATTCCAGG + Intronic
1116942820 14:50808158-50808180 TTTCAAAGATTGTGCCTCCCTGG - Intronic
1123961398 15:25405212-25405234 TCTTAGTCTTTTTGCTTCCCTGG - Intronic
1125387007 15:39148462-39148484 TCTCAAACATTTTGCCTGCCAGG + Intergenic
1125628184 15:41126316-41126338 GCCTAGAGATTTTGCCTGGCAGG - Intergenic
1128258764 15:66217269-66217291 TCTTAGCCATTTTCCCTCTCTGG - Intronic
1131423636 15:92327693-92327715 GCTTAGAGGATTAGCCTCCCTGG + Intergenic
1132211368 15:100025274-100025296 TCTTACTGTTTTTGCTTCCCTGG + Intronic
1132640115 16:974395-974417 TCTTAGAGTTTTTGCTTGACAGG - Intronic
1133290818 16:4719855-4719877 TGTTAGACTTTTTGGCTCCCTGG - Intronic
1134219262 16:12340721-12340743 TCTTAGAGATGTTTGCTGCCGGG - Intronic
1135695558 16:24583121-24583143 TCTGAAAAATTTTACCTCCCAGG - Intergenic
1137464447 16:48695591-48695613 TCTCAGTGATTTTGTCTCCCAGG + Intergenic
1137494389 16:48958558-48958580 TGTGAGAGATTTTGCCTGACTGG + Intergenic
1139091337 16:63651541-63651563 TCTTAGAGATCTTGCATACTAGG - Intergenic
1140054241 16:71511524-71511546 CCCCAGAGGTTTTGCCTCCCAGG + Intronic
1140413587 16:74756865-74756887 GCTTAAATATTTTGCTTCCCTGG - Intronic
1141057785 16:80834550-80834572 ACTGACAGATTTTGCTTCCCTGG + Intergenic
1142026942 16:87819547-87819569 TCCTGGAGGTTTTGACTCCCGGG - Intergenic
1143931737 17:10436065-10436087 ACATAGAAATTTTACCTCCCTGG + Intergenic
1144392086 17:14803207-14803229 TTTTAGAGATTGTGTCACCCAGG + Intergenic
1146076365 17:29733849-29733871 TCTTAGAAATTTTTCCTCCAAGG - Intronic
1146977363 17:37125727-37125749 TCTCAGAGATTATGCAGCCCTGG - Exonic
1147190574 17:38735765-38735787 TCTTAGACCTTTTCCCTCTCTGG - Intronic
1147813340 17:43189840-43189862 CCTTACAGCTTTTACCTCCCTGG + Intronic
1148187929 17:45657926-45657948 TCTTGAAGATTTAGCTTCCCAGG - Intergenic
1151482637 17:74379480-74379502 TCTTGGAAATCTTGCTTCCCTGG + Intergenic
1152127271 17:78454710-78454732 TCTAAGAAAGTGTGCCTCCCTGG - Intronic
1152998436 18:430524-430546 TCTTAGAGATTTTTATTCACTGG - Intronic
1159400196 18:67921483-67921505 GCAGAGATATTTTGCCTCCCTGG + Intergenic
1159466647 18:68791899-68791921 TGATAGAGTTTTTGCCTCTCAGG + Intronic
1159735905 18:72097759-72097781 TCTTAGAGCTTTTGTCATCCTGG + Intergenic
1165272545 19:34723417-34723439 AATGAGAGATTTTTCCTCCCAGG - Intergenic
1166428119 19:42697768-42697790 CCTTAGTGATTTTGCATCACCGG - Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1167111066 19:47461546-47461568 TCTTAGATATTTTTCCTACCAGG - Intronic
1167273484 19:48520238-48520260 TCTTGGAGCTTTTTCTTCCCAGG - Intergenic
927261520 2:21096189-21096211 ACTTAAAGATGTTGGCTCCCTGG - Intergenic
927269911 2:21195521-21195543 TCTTAGTCATTCTGCCTACCAGG - Intergenic
928948698 2:36794829-36794851 TTTTAAAAATATTGCCTCCCTGG - Intronic
929900704 2:46000703-46000725 CCTTAGAGTTTTTGACTCTCAGG + Intronic
930770318 2:55124345-55124367 TATCAGAGACTTTGCCTCCTTGG - Intergenic
931722775 2:65079410-65079432 CCCTAGAGATTTTTCTTCCCAGG - Intronic
931832666 2:66068650-66068672 TCATAGAGATTATGACTCCATGG + Intergenic
933156636 2:78982696-78982718 CCTTGGAGATTTAGCATCCCAGG + Intergenic
935232030 2:101107473-101107495 TCCTAGAGGTTCTGTCTCCCTGG + Intronic
935422133 2:102880236-102880258 TCTTATGGATTTTGTCTCTCTGG - Intergenic
937778978 2:125814955-125814977 TCTTTGAAATTTTGACTGCCAGG + Intergenic
939525492 2:143288697-143288719 TCTTAGGGATTTTGCCCTTCAGG - Intronic
939549969 2:143603085-143603107 CCTTATTGATTTTGCCTGCCTGG + Intronic
944684214 2:202104008-202104030 TCTTGGAGAGTTTGACTCCTGGG + Intronic
945377192 2:209092868-209092890 TCTTAGACATTCTGCCATCCTGG + Intergenic
945408027 2:209473647-209473669 TCTTACAGTTTTGGCCTGCCAGG + Intronic
946564648 2:220950505-220950527 TCCTAGAGATTTTGCTTTCTAGG - Intergenic
1169825641 20:9765725-9765747 TCTTAGATATTTTCTTTCCCAGG + Intronic
1170934150 20:20795421-20795443 TGGGGGAGATTTTGCCTCCCAGG - Intergenic
1173158773 20:40637133-40637155 TCTTAGTGGTTTTGCTTCTCTGG + Intergenic
1173914885 20:46699893-46699915 CGGAAGAGATTTTGCCTCCCAGG + Intergenic
1175012680 20:55755411-55755433 TCTGCTAGATATTGCCTCCCAGG - Intergenic
1175193053 20:57224259-57224281 TCTCAGTGATTTTGGCTGCCAGG - Intronic
1177450093 21:21255330-21255352 TGTTAAAGACTTTGCCTCCCAGG + Intronic
1185043754 22:48518613-48518635 TCTGAGAGAGTCCGCCTCCCAGG - Intronic
949232572 3:1768519-1768541 TCTTACTGATTTTGCTTCTCTGG + Intergenic
951471004 3:23055981-23056003 CCTTAGAGATTTTGACTCAGTGG + Intergenic
951802040 3:26606657-26606679 TCTTAGAGAATTGTCCTCCATGG + Intergenic
952381276 3:32807297-32807319 TCTTAGAGATAGGGTCTCCCAGG - Intergenic
955552012 3:60095208-60095230 TCCTAGAAGTTTTGCCTCCGAGG - Intronic
961166422 3:124766810-124766832 TCTTTTTGATTTTGCATCCCAGG - Intronic
962181493 3:133210470-133210492 CCTTAGAAATTCTGACTCCCAGG - Intronic
962634926 3:137320773-137320795 GAGAAGAGATTTTGCCTCCCAGG - Intergenic
967036560 3:185652479-185652501 TCCTAGAGCTTTTGACTCCCTGG - Intronic
967775927 3:193386010-193386032 TCTTAGAGGTTTTTCTTCCGGGG - Intergenic
967944815 3:194795698-194795720 TCTCTGAGATTTTGCCTGTCTGG + Intergenic
968450366 4:673263-673285 TCTTATAGATTGTCCCTCCCAGG - Intronic
968932650 4:3590074-3590096 GCTTGGAGATTTTGCCAGCCTGG + Intronic
971984065 4:33796368-33796390 GATCAGAGATTTTGCCTTCCAGG - Intergenic
975967382 4:79990422-79990444 GCACAGAGCTTTTGCCTCCCTGG - Intronic
976590870 4:86848776-86848798 TGTTAGAGATGGTGCCCCCCGGG + Exonic
977716339 4:100188153-100188175 TCTTACAGATTTTGACTACTGGG - Exonic
978676354 4:111323224-111323246 TCTTAGAGCTGTGGCATCCCAGG + Intergenic
980905588 4:138945488-138945510 TATTAGACATTTTCCCTACCTGG - Intergenic
981991614 4:150927682-150927704 TCTTAGAGTTTTTGCTTCTGTGG - Intronic
983271469 4:165567317-165567339 CCTTAGAGATTTTCACTTCCTGG + Intergenic
993331606 5:86606978-86607000 TCATAGAGATTCTGGTTCCCAGG + Intergenic
998813381 5:145988334-145988356 TCAGAGAGATTTTGTCTACCTGG - Intronic
999160785 5:149496390-149496412 TCTTAGGGTTTTTCCATCCCTGG - Intronic
1003812908 6:9804583-9804605 CCTTAGAGATTATGCCTTCTTGG - Intronic
1003948009 6:11093177-11093199 GCTTGGAGATTTTGCCGCACTGG - Intergenic
1004183389 6:13400120-13400142 TTTTAGAGCTTTTGCCATCCAGG - Intronic
1007954728 6:45906411-45906433 TTGTAGAGATTTTAACTCCCTGG + Intronic
1012439586 6:99251037-99251059 TCTTAGAGACTTTGCCTAAGAGG + Intergenic
1013635176 6:112022331-112022353 TCTTTTTGATTGTGCCTCCCAGG + Intergenic
1013796961 6:113898934-113898956 TCTTATTGATTCTGCCTCTCTGG + Intergenic
1013959252 6:115879187-115879209 TCTTACAGATCTTCCCTCCATGG - Intergenic
1016420912 6:143882075-143882097 TCTTAGAGAAGTTGCCTACTTGG + Intronic
1017215345 6:151900662-151900684 TCTTAGAGATGTGGCTTCCTGGG + Intronic
1027001623 7:74658138-74658160 TATTAGAGACTTTGCCCCGCCGG + Intronic
1027333394 7:77122668-77122690 TCTTTGGGATTTGGCCTCCTGGG - Exonic
1027820740 7:83040794-83040816 ACTCAGAGATTTTGCCTGCGGGG - Intronic
1030613311 7:111712252-111712274 TCTCAGAGGTTGTGCCTCCATGG + Intergenic
1033216255 7:139495713-139495735 TCTAAGAGATTGGTCCTCCCAGG + Intergenic
1035115916 7:156523831-156523853 TCTTGGAGATTTTTCCTTCTGGG - Intergenic
1037383451 8:18312863-18312885 ACTTAGATATTTTACTTCCCAGG - Intergenic
1038298038 8:26314546-26314568 TTTTTGAGATCTTGCCTGCCTGG + Intronic
1038622469 8:29157077-29157099 CCTTACAGATTTTTCCTCCAAGG + Intronic
1041240370 8:55844248-55844270 GCTCAGAGCTGTTGCCTCCCGGG + Intergenic
1042883828 8:73525012-73525034 TCTTGGATATTTGGGCTCCCTGG - Intronic
1048261047 8:132945298-132945320 TCTTATTGAATTTGCCTCCTGGG - Intronic
1051589253 9:18759535-18759557 CCTAAGAGTTTTTTCCTCCCTGG - Intronic
1054457472 9:65441821-65441843 GCTTGGAGATTTTGCCAGCCTGG - Intergenic
1055358232 9:75460338-75460360 TCCTAAAGACTTTGCCTCCTGGG + Intergenic
1058567270 9:106299603-106299625 TCTGAGAGACTTTTTCTCCCTGG + Intergenic
1186083225 X:5956292-5956314 TCTTAAAAATTTTGACTCCCAGG - Intronic
1193151279 X:78127182-78127204 TCTTAGAGATTTTGCCTCCCAGG - Exonic
1193551461 X:82897867-82897889 TCTTAGATATTTTGCTCACCAGG + Intergenic
1194885199 X:99306623-99306645 TGTCAGAGATTTTGCCTCTTTGG + Intergenic
1196581307 X:117382221-117382243 TGTCAGTGATTTTGCCTCCCAGG - Intergenic
1196617750 X:117786791-117786813 TCTTAGATATTCTGCTGCCCAGG - Intergenic
1197009727 X:121545938-121545960 TTTCAGAGATTCTGACTCCCAGG + Intergenic
1200775516 Y:7166992-7167014 TCTGAGAGAGCTTGCCTTCCTGG + Intergenic