ID: 1193178244 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:78420834-78420856 |
| Sequence | TTTAGCATCTCCTTTGGTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193178244_1193178248 | 20 | Left | 1193178244 | X:78420834-78420856 | CCTCAACCAAAGGAGATGCTAAA | No data | ||
| Right | 1193178248 | X:78420877-78420899 | CAGCACCACCATGTTGTAGGAGG | No data | ||||
| 1193178244_1193178247 | 17 | Left | 1193178244 | X:78420834-78420856 | CCTCAACCAAAGGAGATGCTAAA | No data | ||
| Right | 1193178247 | X:78420874-78420896 | GTTCAGCACCACCATGTTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193178244 | Original CRISPR | TTTAGCATCTCCTTTGGTTG AGG (reversed) | Intergenic | ||