ID: 1193178247

View in Genome Browser
Species Human (GRCh38)
Location X:78420874-78420896
Sequence GTTCAGCACCACCATGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193178245_1193178247 11 Left 1193178245 X:78420840-78420862 CCAAAGGAGATGCTAAATTAGAG No data
Right 1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG No data
1193178244_1193178247 17 Left 1193178244 X:78420834-78420856 CCTCAACCAAAGGAGATGCTAAA No data
Right 1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193178247 Original CRISPR GTTCAGCACCACCATGTTGT AGG Intergenic
No off target data available for this crispr