ID: 1193186709

View in Genome Browser
Species Human (GRCh38)
Location X:78521979-78522001
Sequence TGCAGGAGGCAGAGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193186705_1193186709 14 Left 1193186705 X:78521942-78521964 CCAGTGTTTTTAGGAGTAAGTGA No data
Right 1193186709 X:78521979-78522001 TGCAGGAGGCAGAGAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193186709 Original CRISPR TGCAGGAGGCAGAGAGCAAG AGG Intergenic
No off target data available for this crispr