ID: 1193187128

View in Genome Browser
Species Human (GRCh38)
Location X:78526773-78526795
Sequence TGGGATCCTCAAAATTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193187121_1193187128 26 Left 1193187121 X:78526724-78526746 CCTAACCTCGCAGGATGTCTGCT No data
Right 1193187128 X:78526773-78526795 TGGGATCCTCAAAATTGACATGG No data
1193187122_1193187128 21 Left 1193187122 X:78526729-78526751 CCTCGCAGGATGTCTGCTGTTAA No data
Right 1193187128 X:78526773-78526795 TGGGATCCTCAAAATTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193187128 Original CRISPR TGGGATCCTCAAAATTGACA TGG Intergenic
No off target data available for this crispr