ID: 1193187234

View in Genome Browser
Species Human (GRCh38)
Location X:78527841-78527863
Sequence TTTATTAAGGTGATTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193187231_1193187234 -4 Left 1193187231 X:78527822-78527844 CCAAAGGGACTTATGGCCTTTTA No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187229_1193187234 -2 Left 1193187229 X:78527820-78527842 CCCCAAAGGGACTTATGGCCTTT No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187228_1193187234 2 Left 1193187228 X:78527816-78527838 CCTTCCCCAAAGGGACTTATGGC No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187225_1193187234 7 Left 1193187225 X:78527811-78527833 CCCAGCCTTCCCCAAAGGGACTT No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187224_1193187234 10 Left 1193187224 X:78527808-78527830 CCTCCCAGCCTTCCCCAAAGGGA No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187226_1193187234 6 Left 1193187226 X:78527812-78527834 CCAGCCTTCCCCAAAGGGACTTA No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data
1193187230_1193187234 -3 Left 1193187230 X:78527821-78527843 CCCAAAGGGACTTATGGCCTTTT No data
Right 1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193187234 Original CRISPR TTTATTAAGGTGATTGTGCA TGG Intergenic
No off target data available for this crispr