ID: 1193189159 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:78548964-78548986 |
| Sequence | CTGAACAATAGGAAAGTGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193189156_1193189159 | 6 | Left | 1193189156 | X:78548935-78548957 | CCACATAAACAGGCTCTAGCAGA | No data | ||
| Right | 1193189159 | X:78548964-78548986 | CTGAACAATAGGAAAGTGGCAGG | No data | ||||
| 1193189155_1193189159 | 12 | Left | 1193189155 | X:78548929-78548951 | CCACAGCCACATAAACAGGCTCT | No data | ||
| Right | 1193189159 | X:78548964-78548986 | CTGAACAATAGGAAAGTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193189159 | Original CRISPR | CTGAACAATAGGAAAGTGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||