ID: 1193189159

View in Genome Browser
Species Human (GRCh38)
Location X:78548964-78548986
Sequence CTGAACAATAGGAAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193189156_1193189159 6 Left 1193189156 X:78548935-78548957 CCACATAAACAGGCTCTAGCAGA No data
Right 1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG No data
1193189155_1193189159 12 Left 1193189155 X:78548929-78548951 CCACAGCCACATAAACAGGCTCT No data
Right 1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193189159 Original CRISPR CTGAACAATAGGAAAGTGGC AGG Intergenic
No off target data available for this crispr