ID: 1193191281

View in Genome Browser
Species Human (GRCh38)
Location X:78573761-78573783
Sequence CTGTCAAAACAGGTGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193191281_1193191287 0 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191287 X:78573784-78573806 CTGGGGACTAAGATTAACTGAGG No data
1193191281_1193191292 24 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191292 X:78573808-78573830 GAGTGTGGTGTTGCTGGAAGAGG No data
1193191281_1193191288 1 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191288 X:78573785-78573807 TGGGGACTAAGATTAACTGAGGG No data
1193191281_1193191290 9 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191290 X:78573793-78573815 AAGATTAACTGAGGGGAGTGTGG No data
1193191281_1193191289 2 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191289 X:78573786-78573808 GGGGACTAAGATTAACTGAGGGG No data
1193191281_1193191291 18 Left 1193191281 X:78573761-78573783 CCATGTACCACCTGTTTTGACAG No data
Right 1193191291 X:78573802-78573824 TGAGGGGAGTGTGGTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193191281 Original CRISPR CTGTCAAAACAGGTGGTACA TGG (reversed) Intergenic
No off target data available for this crispr