ID: 1193200587

View in Genome Browser
Species Human (GRCh38)
Location X:78685686-78685708
Sequence CTGGCTAGGTCTTAAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193200585_1193200587 -9 Left 1193200585 X:78685672-78685694 CCTACTATTGATTTCTGGCTAGG No data
Right 1193200587 X:78685686-78685708 CTGGCTAGGTCTTAAGCAACAGG No data
1193200583_1193200587 3 Left 1193200583 X:78685660-78685682 CCTAATACTAGACCTACTATTGA No data
Right 1193200587 X:78685686-78685708 CTGGCTAGGTCTTAAGCAACAGG No data
1193200582_1193200587 4 Left 1193200582 X:78685659-78685681 CCCTAATACTAGACCTACTATTG No data
Right 1193200587 X:78685686-78685708 CTGGCTAGGTCTTAAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193200587 Original CRISPR CTGGCTAGGTCTTAAGCAAC AGG Intergenic
No off target data available for this crispr