ID: 1193209562 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:78789972-78789994 |
| Sequence | TCTGACATCATGATGCTAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193209562_1193209564 | 20 | Left | 1193209562 | X:78789972-78789994 | CCAACTAGCATCATGATGTCAGA | No data | ||
| Right | 1193209564 | X:78790015-78790037 | TATTAGTCTTAAATGTAAATGGG | No data | ||||
| 1193209562_1193209563 | 19 | Left | 1193209562 | X:78789972-78789994 | CCAACTAGCATCATGATGTCAGA | No data | ||
| Right | 1193209563 | X:78790014-78790036 | ATATTAGTCTTAAATGTAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193209562 | Original CRISPR | TCTGACATCATGATGCTAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||