ID: 1193209562

View in Genome Browser
Species Human (GRCh38)
Location X:78789972-78789994
Sequence TCTGACATCATGATGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193209562_1193209564 20 Left 1193209562 X:78789972-78789994 CCAACTAGCATCATGATGTCAGA No data
Right 1193209564 X:78790015-78790037 TATTAGTCTTAAATGTAAATGGG No data
1193209562_1193209563 19 Left 1193209562 X:78789972-78789994 CCAACTAGCATCATGATGTCAGA No data
Right 1193209563 X:78790014-78790036 ATATTAGTCTTAAATGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193209562 Original CRISPR TCTGACATCATGATGCTAGT TGG (reversed) Intergenic
No off target data available for this crispr