ID: 1193211200

View in Genome Browser
Species Human (GRCh38)
Location X:78809126-78809148
Sequence CTGCAAGCAGAAGTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193211200_1193211205 1 Left 1193211200 X:78809126-78809148 CCCACCACCACTTCTGCTTGCAG No data
Right 1193211205 X:78809150-78809172 CAGCACCCAAACACACAATCTGG No data
1193211200_1193211206 2 Left 1193211200 X:78809126-78809148 CCCACCACCACTTCTGCTTGCAG No data
Right 1193211206 X:78809151-78809173 AGCACCCAAACACACAATCTGGG No data
1193211200_1193211209 11 Left 1193211200 X:78809126-78809148 CCCACCACCACTTCTGCTTGCAG No data
Right 1193211209 X:78809160-78809182 ACACACAATCTGGGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193211200 Original CRISPR CTGCAAGCAGAAGTGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr