ID: 1193212835

View in Genome Browser
Species Human (GRCh38)
Location X:78827861-78827883
Sequence GTGAAGAAACTGAGGCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193212835_1193212839 20 Left 1193212835 X:78827861-78827883 CCATTGAGCCTCAGTTTCTTCAC No data
Right 1193212839 X:78827904-78827926 TAAAAGGTAGTGTGTAAATGAGG No data
1193212835_1193212841 29 Left 1193212835 X:78827861-78827883 CCATTGAGCCTCAGTTTCTTCAC No data
Right 1193212841 X:78827913-78827935 GTGTGTAAATGAGGGCTGCCTGG No data
1193212835_1193212837 4 Left 1193212835 X:78827861-78827883 CCATTGAGCCTCAGTTTCTTCAC No data
Right 1193212837 X:78827888-78827910 AATATGTACTCACCAGTAAAAGG No data
1193212835_1193212840 21 Left 1193212835 X:78827861-78827883 CCATTGAGCCTCAGTTTCTTCAC No data
Right 1193212840 X:78827905-78827927 AAAAGGTAGTGTGTAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193212835 Original CRISPR GTGAAGAAACTGAGGCTCAA TGG (reversed) Intergenic
No off target data available for this crispr