ID: 1193213423

View in Genome Browser
Species Human (GRCh38)
Location X:78835318-78835340
Sequence TAGGAGAAGAATCTTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193213423_1193213428 -1 Left 1193213423 X:78835318-78835340 CCAACCCCAAGATTCTTCTCCTA No data
Right 1193213428 X:78835340-78835362 AAACCCAGAGACACAGTGAATGG No data
1193213423_1193213431 25 Left 1193213423 X:78835318-78835340 CCAACCCCAAGATTCTTCTCCTA No data
Right 1193213431 X:78835366-78835388 GCATAGTACGCAAAACTTGTAGG No data
1193213423_1193213433 29 Left 1193213423 X:78835318-78835340 CCAACCCCAAGATTCTTCTCCTA No data
Right 1193213433 X:78835370-78835392 AGTACGCAAAACTTGTAGGAGGG No data
1193213423_1193213432 28 Left 1193213423 X:78835318-78835340 CCAACCCCAAGATTCTTCTCCTA No data
Right 1193213432 X:78835369-78835391 TAGTACGCAAAACTTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193213423 Original CRISPR TAGGAGAAGAATCTTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr