ID: 1193213542

View in Genome Browser
Species Human (GRCh38)
Location X:78836611-78836633
Sequence GTAGTATGCATGTGTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193213542_1193213547 23 Left 1193213542 X:78836611-78836633 CCAGTTCCACACATGCATACTAC No data
Right 1193213547 X:78836657-78836679 CCATGCCCCTCTCTAATCAATGG No data
1193213542_1193213548 24 Left 1193213542 X:78836611-78836633 CCAGTTCCACACATGCATACTAC No data
Right 1193213548 X:78836658-78836680 CATGCCCCTCTCTAATCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193213542 Original CRISPR GTAGTATGCATGTGTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr