ID: 1193213809

View in Genome Browser
Species Human (GRCh38)
Location X:78839307-78839329
Sequence TACATTTTTACATAAACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193213809_1193213813 27 Left 1193213809 X:78839307-78839329 CCTATTGTTTATGTAAAAATGTA No data
Right 1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG No data
1193213809_1193213811 13 Left 1193213809 X:78839307-78839329 CCTATTGTTTATGTAAAAATGTA No data
Right 1193213811 X:78839343-78839365 AGACTAAATTGTGTATTCAGTGG 0: 38
1: 47
2: 39
3: 26
4: 182
1193213809_1193213812 17 Left 1193213809 X:78839307-78839329 CCTATTGTTTATGTAAAAATGTA No data
Right 1193213812 X:78839347-78839369 TAAATTGTGTATTCAGTGGAAGG 0: 39
1: 112
2: 149
3: 122
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193213809 Original CRISPR TACATTTTTACATAAACAAT AGG (reversed) Intergenic
No off target data available for this crispr