ID: 1193213810

View in Genome Browser
Species Human (GRCh38)
Location X:78839341-78839363
Sequence ACTGAATACACAATTTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 41, 1: 63, 2: 47, 3: 40, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193213810_1193213813 -7 Left 1193213810 X:78839341-78839363 CCAGACTAAATTGTGTATTCAGT 0: 41
1: 63
2: 47
3: 40
4: 372
Right 1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193213810 Original CRISPR ACTGAATACACAATTTAGTC TGG (reversed) Intergenic
900360830 1:2288147-2288169 ACTAAATACAAAAATTAGCCAGG - Intronic
900653662 1:3744299-3744321 ACTAAAAACACAAATTAGCCGGG + Intergenic
902007266 1:13242373-13242395 AAAAAATACAAAATTTAGTCAGG - Intergenic
902026317 1:13386682-13386704 AAAAAATACAAAATTTAGTCAGG - Intergenic
902340385 1:15779463-15779485 ACTAAATACAAAAATTAGTCAGG - Intronic
904093172 1:27959319-27959341 ACTAAAAATACAAATTAGTCGGG - Intergenic
904218545 1:28944695-28944717 ACTAAATACAAAAATTAGCCGGG - Intronic
904347218 1:29880820-29880842 ACTGAATACACAATTTACATGGG - Intergenic
904522417 1:31105839-31105861 ACAAAATACAAAAATTAGTCAGG + Intergenic
904913238 1:33950967-33950989 ACTGATTACAGCATTGAGTCGGG + Intronic
905364654 1:37443559-37443581 ACTAAATAAATAAATTAGTCAGG + Intergenic
905786101 1:40758988-40759010 AAGGAATTCACAATTTAGTTGGG + Intronic
907897422 1:58704809-58704831 ACTGAATACACAATTTAGACTGG - Intergenic
909650492 1:77970880-77970902 ACTAAATACAAAAATTAGCCAGG + Intronic
912056090 1:105599592-105599614 AATGAACACACAATTTAGTCTGG + Intergenic
912074179 1:105851251-105851273 ACTCAATTCAAAATTTAGTCTGG - Intergenic
912314809 1:108658296-108658318 ACTAAATACAAAAATTAGCCAGG - Intronic
915219400 1:154362278-154362300 ACTGAATACACAATTTATTCTGG - Intergenic
915425570 1:155823730-155823752 ACTGAAAATACAAATTAGCCGGG + Intronic
915879842 1:159657884-159657906 ACTAAATACAAAAATTAGCCGGG - Intergenic
916227948 1:162508539-162508561 ACTAAAAACACAATTTAGCTGGG + Intronic
916989694 1:170229024-170229046 ACTGAATACACAGCTGAGTCTGG + Intergenic
917339214 1:173957072-173957094 CCTGAATACAAAAATTAGCCGGG - Intronic
917390857 1:174534612-174534634 ACTAAATACAAAAATTAGCCGGG + Intronic
917467297 1:175291874-175291896 ACTGAATACATAAATTACTTTGG - Intergenic
917622890 1:176815840-176815862 ACTGAATCCACAATTTAGTCTGG + Intronic
918011089 1:180587156-180587178 AATAAATACAAAAATTAGTCGGG - Intergenic
918581376 1:186134426-186134448 ATTGAATACATAATGTAATCAGG + Intronic
918722767 1:187874914-187874936 AATGAATACAATATTTAGTCAGG + Intergenic
918952983 1:191164456-191164478 ACTAAAAATACAAATTAGTCGGG - Intergenic
919519572 1:198571154-198571176 AAAGAATACAAAAATTAGTCGGG - Intergenic
919614545 1:199789107-199789129 ACTGAAGACACAATTAATCCTGG - Intergenic
920326080 1:205165251-205165273 ACTAAATACAAAAATTAGTCTGG - Intronic
920604490 1:207367503-207367525 TCTGAATACAAAAATTAGCCAGG - Intergenic
921359858 1:214320952-214320974 AATGAATACATAATTTTTTCTGG + Intronic
921384429 1:214554205-214554227 ACAAAATACAAAAATTAGTCAGG + Intergenic
922084703 1:222335156-222335178 ACAGAATACACACTTTAGTCTGG + Intergenic
922410529 1:225370125-225370147 ACTGAAAACAAAAATTAGCCTGG + Intronic
922526112 1:226305516-226305538 AAAGAAGACATAATTTAGTCAGG + Intronic
922694777 1:227724338-227724360 AATGAATACACAATTTACGTTGG - Intergenic
922847870 1:228704091-228704113 ACTGGATACAAAATATAGTCTGG - Intergenic
922965254 1:229685078-229685100 ACTAAATACAAAAATTAGCCAGG - Intergenic
923569742 1:235102816-235102838 ACTAAATACAAAAATTAGCCAGG + Intergenic
924185541 1:241485569-241485591 ACTGAGTACACAATACAGACAGG - Intergenic
924206429 1:241716095-241716117 ACTGAAAACACATTTTTCTCAGG + Intronic
924677897 1:246199212-246199234 ACCTAATACAAAATTCAGTCTGG + Intronic
1064182899 10:13134721-13134743 ACTGAAAATACAAATTAGCCGGG - Intronic
1064906607 10:20353420-20353442 ACTAAATACAAAAATTAGCCAGG + Intergenic
1065708382 10:28491946-28491968 AAAAAATACAAAATTTAGTCGGG + Intergenic
1068048849 10:51922846-51922868 GCAGAATACACATTTTATTCAGG - Intronic
1068539865 10:58280140-58280162 AATGAATAAAGAATCTAGTCTGG + Intronic
1068904901 10:62311775-62311797 ACTGAATGCACAATTTAGTCTGG + Intergenic
1069572928 10:69505310-69505332 GCAGAAGACACAATGTAGTCAGG + Intronic
1070012845 10:72493611-72493633 AAAAAATACACAAATTAGTCAGG - Intronic
1070500819 10:77071036-77071058 ACTGAAAACACATTTTCCTCTGG - Intronic
1070900015 10:80020457-80020479 ACTAAATACAAAAATTAGCCAGG - Intergenic
1071674867 10:87646193-87646215 ACTGAAAACCCAAATCAGTCAGG + Intergenic
1072174001 10:92897723-92897745 ACTGAATATACAATTTAGTCTGG - Intronic
1072357118 10:94622731-94622753 ACAGAATACACAATTTAATATGG + Intergenic
1072572595 10:96671878-96671900 AAAAAATACAAAATTTAGTCAGG + Intronic
1072928192 10:99635515-99635537 ACTAAATACAAAAATTAGCCTGG + Intergenic
1073346239 10:102785034-102785056 ACAAAATACAAAATTTAGCCGGG - Intronic
1073646560 10:105310649-105310671 ACTGACAAAACATTTTAGTCAGG - Intergenic
1074782973 10:116815412-116815434 TCTGAATACAAAAATTAGCCAGG + Intergenic
1075769675 10:124922794-124922816 GCTGAATACAAAAATTAGCCAGG - Intergenic
1075975514 10:126690693-126690715 ACTGAATACACAATTTAGTCTGG + Intergenic
1076224829 10:128765536-128765558 ACTAAATACAAACTTTATTCAGG - Intergenic
1076977852 11:189138-189160 ACTGAATACACAATTTAGTCTGG - Intronic
1076984961 11:229282-229304 ACTAAATACAAAAATTAGCCGGG + Intronic
1078382952 11:10860556-10860578 ATTGAATACATAATGTAGGCCGG + Intergenic
1078633042 11:13022205-13022227 GCTGAATACACATTTTTCTCAGG - Intergenic
1079204681 11:18404246-18404268 AATAAATACACAAATTAGCCAGG + Intronic
1080495987 11:32819621-32819643 ACAAAATACAAAAATTAGTCAGG - Intergenic
1080911459 11:36603759-36603781 TCAGAATACAAAAATTAGTCAGG + Intronic
1081202298 11:40231716-40231738 ACTGAAGACCCTATATAGTCTGG + Intronic
1081529765 11:43950069-43950091 ACTGAATACACAATGTAGTCTGG - Intergenic
1081962080 11:47145447-47145469 ACTAAATACAAAAATTAGTCGGG + Intronic
1082736802 11:56865185-56865207 TCTGAATACACAATTTAGTCTGG - Intergenic
1082903700 11:58283807-58283829 ACTGGATTCACACTTTAGTGAGG + Intergenic
1083383453 11:62288311-62288333 ACTGAATACACAATTTAGTATGG + Intergenic
1083892377 11:65602347-65602369 ACTAAATACAAAAATTAGGCCGG + Intronic
1085121572 11:73970737-73970759 ACTAAATACAAAAATTAGCCAGG + Intergenic
1087025148 11:93642236-93642258 ACTAAATACAAAAATTAGCCGGG + Intergenic
1087037548 11:93770336-93770358 ACTGAATACACAATTTAGTCTGG - Intronic
1087590876 11:100186209-100186231 ACTAAATACAAAAATTAGCCAGG + Intronic
1088594518 11:111430370-111430392 ACTGAATACACAATTTAGTTTGG + Intronic
1089429324 11:118408596-118408618 TCTGAATAGACATTTTTGTCTGG - Intronic
1089822813 11:121244027-121244049 AAAAAATACACAAATTAGTCGGG + Intergenic
1090956178 11:131514747-131514769 AAAGAATACAAAACTTAGTCAGG - Intronic
1091414590 12:270370-270392 ACAAAATACAAAAATTAGTCAGG - Intergenic
1093026762 12:14252646-14252668 ACTAAAAACACAAATTAGCCGGG + Intergenic
1093057636 12:14570498-14570520 ACAGAATACACAACTTAGTCTGG - Intergenic
1093080526 12:14805400-14805422 ACTGATTACACAATGTAAACCGG - Exonic
1093455388 12:19360167-19360189 ACTGAATACAAAAATTAGCCAGG + Intronic
1094614491 12:32023864-32023886 ACTGAATACACAATTTAGGCTGG + Intergenic
1095237933 12:39821247-39821269 ACTAAATACAAAAATTAGCCGGG + Intronic
1095468827 12:42515398-42515420 ACTAAATACAAAAATTAGTCGGG - Intronic
1095828938 12:46562091-46562113 ACTGAATACACAATGTAATCTGG - Intergenic
1095979120 12:47960772-47960794 ATTGAATACACAATTTAGTCTGG + Intergenic
1096813282 12:54185145-54185167 ACTAAAAATACAAATTAGTCAGG + Intronic
1096831325 12:54316730-54316752 ACTAAATACAAAAATTAGCCGGG + Intronic
1096904747 12:54925101-54925123 ACCGAATACACAATTTAGTCTGG + Intergenic
1097187519 12:57203709-57203731 CCTGAATACACATTTTTGTGCGG + Intronic
1097251538 12:57635511-57635533 ACTTAATACAAAAATTAGCCAGG + Intergenic
1098486059 12:71023304-71023326 ACTGAATACACAATTTAGTCTGG + Intergenic
1098540738 12:71653851-71653873 ACTAAATACAAAAATTAGCCGGG + Intronic
1098766039 12:74490235-74490257 TCTGATTAAACAATTTAATCAGG - Intergenic
1099070689 12:78042628-78042650 ACTAAATACAAAAATTAGCCGGG + Intronic
1099193189 12:79582104-79582126 ACTAAATACAAAAATTAGCCAGG + Intronic
1099546941 12:83995179-83995201 ACTGAATTCAAAATTTAGCTTGG - Intergenic
1100368664 12:93944602-93944624 CCTGAATACAGAAATTAGCCAGG - Intergenic
1101056258 12:100918164-100918186 ACAAAATACACAAATTAGCCAGG + Intronic
1102100167 12:110272288-110272310 AAAAAATACAAAATTTAGTCAGG + Intergenic
1103052255 12:117790406-117790428 ACTAAATACACAATTCAGTCTGG + Intronic
1103113281 12:118301679-118301701 ACTAAATACAAAAATTAGCCAGG + Intronic
1103199603 12:119076635-119076657 ACTGAATAGAAAATTTATTTTGG + Intronic
1104018016 12:124973253-124973275 ACTAAATACAAAAATTAGCCGGG + Intronic
1104249919 12:127082571-127082593 ACTGATTACACACATTTGTCAGG + Intergenic
1104309812 12:127644322-127644344 ACTAAATACACAGTTTAGTCTGG + Intergenic
1105909528 13:24849172-24849194 ACTGAGTAAACAATTAATTCTGG - Intronic
1106616017 13:31328530-31328552 ACTAAATACAAAAATTAGCCAGG + Intronic
1107014324 13:35696358-35696380 ACTAAATACAAAAATTAGCCAGG - Intergenic
1107055258 13:36096354-36096376 ACTGAATACACAATCTTTTCTGG + Intronic
1107174580 13:37385484-37385506 GCTGAATACACAATTTAGTCTGG - Intergenic
1107299971 13:38955454-38955476 ACTGAATAAACAACTATGTCTGG + Intergenic
1107621544 13:42236740-42236762 ACTTAATACAAAAATTAGCCAGG + Intronic
1107744128 13:43487008-43487030 ACTAAATACAAAAATTAGCCAGG + Intronic
1107854380 13:44600344-44600366 AAAAAATACACAAATTAGTCAGG - Intergenic
1108271660 13:48766998-48767020 ACTGAATATCCAATTTAGTCTGG + Intergenic
1108487629 13:50942921-50942943 ACTGAATACACAATGTAGTCTGG + Intronic
1108607236 13:52051997-52052019 ACTGAATACACAATTTAGTCTGG - Intronic
1109291873 13:60486229-60486251 ACTGAACACACTTTTTATTCTGG + Intronic
1109422373 13:62130789-62130811 ACTGAATACACAATTTTGTCTGG - Intergenic
1109423166 13:62139540-62139562 ACTGAATATACAATTTAGTCTGG - Intergenic
1109601992 13:64643433-64643455 GATCAATACACAATTTAGTGTGG - Intergenic
1109960448 13:69621972-69621994 GCTGAATACACAATTTAGTGTGG - Intergenic
1110605444 13:77426867-77426889 ACTGAATACACAATTTAGTCTGG - Intergenic
1110965156 13:81685506-81685528 ACTGAATACACAATTTAACCTGG + Intergenic
1111368614 13:87285481-87285503 ACTGAATACACAATTGAGTCTGG - Intergenic
1111788212 13:92818171-92818193 ACTGAAGACAAAAATTAGCCAGG - Intronic
1112872514 13:103992500-103992522 AAAAAATACACAAGTTAGTCAGG - Intergenic
1116116496 14:40658229-40658251 ACTAAAAACAAAAATTAGTCGGG - Intergenic
1117926875 14:60790411-60790433 ACTGAATACACAATTTAGTCTGG - Intronic
1118272811 14:64359470-64359492 ACTAAATACAAAAATTAGCCAGG - Intergenic
1118577409 14:67257185-67257207 ACTGAATACACGGTTTAGTCTGG + Intronic
1119658531 14:76434497-76434519 ACAGAATACAAAAATTAGCCAGG + Intronic
1120309627 14:82813293-82813315 ACTAAATACAAAAATTAGCCAGG + Intergenic
1120815725 14:88855922-88855944 ACAAAATACAAAAGTTAGTCGGG + Intronic
1121218370 14:92265951-92265973 AAAGAATACAAAATTTAGCCGGG + Intergenic
1123437884 15:20268976-20268998 ACTAAAAACACAAATTAGCCAGG + Intergenic
1123872335 15:24589510-24589532 ACTGAATACACAATTTAGTCTGG + Intergenic
1123883324 15:24696366-24696388 ACTGAATACACAATTTAGTCTGG + Intergenic
1124973524 15:34513780-34513802 ACTAAAAACACAAGTTAGCCAGG + Intergenic
1125201072 15:37101080-37101102 ACTTAATAAAAAATTTAGCCCGG - Intronic
1125999708 15:44197038-44197060 ACTGAATACAAAAATTAGCCGGG + Intergenic
1126605358 15:50470758-50470780 ACTAAATACAAAAATTAGCCGGG - Intronic
1127102135 15:55577202-55577224 ACTGAATACATAATTTAGTCTGG - Intronic
1127229065 15:56968971-56968993 ACTGAATAGACACTTTAGTCTGG + Intronic
1128659315 15:69486429-69486451 TGTGAATACAAAATTTGGTCAGG + Intergenic
1129973334 15:79799875-79799897 ACTAAATACAAAAATTAGCCGGG - Intergenic
1131078999 15:89518636-89518658 AATGAATACAAAAATTAGCCGGG + Intergenic
1131547544 15:93328561-93328583 ACTGAATACACCATTTAGACTGG - Intergenic
1133968688 16:10551109-10551131 AGTGAGTACACAATTTACTTTGG - Intronic
1134333821 16:13275272-13275294 ACTGCATAGACAATTTTGCCTGG + Intergenic
1134371714 16:13632133-13632155 ACCGAATACACAGTTTAGTGTGG - Intergenic
1135007786 16:18842662-18842684 AAAGAATACAAAAGTTAGTCAGG + Intronic
1135213781 16:20546653-20546675 CCTGAACAAACAATTTAGTGAGG - Intronic
1135916841 16:26612955-26612977 AAAGAATACAAAATTTAGCCAGG - Intergenic
1136846691 16:33581876-33581898 ACTAAAAACACAAATTAGCCAGG - Intergenic
1137270022 16:46897210-46897232 ACTAAATACAAAAATTAGCCGGG + Intronic
1137585171 16:49659935-49659957 AATGGATGCACACTTTAGTCAGG + Intronic
1141098833 16:81182135-81182157 ACTGAAAATACAAATTAGTTGGG - Intergenic
1141384976 16:83613670-83613692 AATAAATACAAAAATTAGTCAGG + Intronic
1142212282 16:88813958-88813980 ACTGAATACACGATTGAGTCTGG - Exonic
1142403287 16:89872378-89872400 ACTGAGTACAAAAATTAGCCGGG + Intergenic
1142442480 16:90108195-90108217 ACTGAATACACAATTTAGTCTGG + Intergenic
1203108399 16_KI270728v1_random:1430531-1430553 ACTAAAAACACAAATTAGCCAGG - Intergenic
1142465273 17:133603-133625 ACTGAATACACAATTTAGTCTGG - Intergenic
1142609334 17:1099963-1099985 ACTAAATACAAAAATTAGCCAGG + Intronic
1143467244 17:7145738-7145760 ACTGAACACACAATTTAGTCTGG - Intergenic
1144419684 17:15084759-15084781 ACTAAATACACAATTTAGCCTGG + Intergenic
1144481885 17:15636569-15636591 ACTGAATACACACATTGCTCTGG - Intronic
1145223151 17:21105654-21105676 ACTGAATACACAATTTAGAATGG + Intergenic
1146861501 17:36304229-36304251 ACTAAAAACAAAAATTAGTCAGG + Intronic
1147091831 17:38108333-38108355 ACTAAAAACAAAAATTAGTCAGG + Intergenic
1147105380 17:38212167-38212189 ACTAAAAACAAAAATTAGTCAGG - Intergenic
1147372330 17:40001549-40001571 AATAAATACAAAACTTAGTCAGG + Intergenic
1148033652 17:44641093-44641115 ACTGAATAAAAAATTTATTATGG + Intergenic
1148424122 17:47576329-47576351 ACTAAAAACAAAAATTAGTCAGG + Intronic
1148431246 17:47645582-47645604 ACTTAATACAAAAATTAGCCAGG - Intergenic
1148925612 17:51082212-51082234 ACTAAATACAAAAATTAGCCAGG + Intronic
1149084850 17:52703597-52703619 AATAAATACAAAATTTAGCCAGG - Intergenic
1149104129 17:52942177-52942199 TCTGAATACACAATATAGTCTGG + Intergenic
1150099654 17:62411604-62411626 ACTAAATACAAAAATTAGTCAGG + Intronic
1150254054 17:63729996-63730018 ACTAAATACAAAAATTAGCCAGG - Intronic
1151483662 17:74385228-74385250 ACTGAATCCACATTTTACACAGG + Intergenic
1152753093 17:82075245-82075267 ACAAAATACAAAAATTAGTCGGG - Intergenic
1152799987 17:82326437-82326459 AAAAAATACACAATTTAGCCAGG + Intronic
1152998406 18:430173-430195 ACTGAATACAAAAATTAGCCAGG + Intronic
1153021961 18:637308-637330 ACTGAATTCTCAAGTTAGTTGGG + Intronic
1153851543 18:9099957-9099979 ACTGAATACAAAATTTAGTCTGG + Intergenic
1154150363 18:11901676-11901698 ACTAAATACAAAAATTAGGCAGG + Intronic
1154328298 18:13408211-13408233 AAAAAATACACAATTTAGCCAGG + Intronic
1154375601 18:13806950-13806972 ACTAAATACAAAAATTAGCCAGG - Intergenic
1154468657 18:14675076-14675098 AATAAATACACAATTTTATCAGG - Intergenic
1156300236 18:35830055-35830077 CCTGAATACACAGTTTACTATGG - Intergenic
1156662130 18:39358607-39358629 ATTTAATACAAAATTTAGCCAGG + Intergenic
1157800215 18:50613526-50613548 AGTGTAGACACAATTTAGTTGGG - Intronic
1157852481 18:51069275-51069297 ACTAAATACAAAAATTAGCCAGG - Intronic
1158275359 18:55760914-55760936 ACAGAAGACACAGTTTGGTCCGG + Intergenic
1158369709 18:56786366-56786388 ACTAAATACAAAATTTAGCCGGG + Intronic
1158590359 18:58773923-58773945 ACAGAATACAAAAATTAGCCAGG + Intergenic
1158994101 18:62899606-62899628 ACAGATTTCACAATTTAGTAAGG - Intronic
1159794760 18:72828148-72828170 ACTAAATACAAAAATTAGCCAGG + Intronic
1161374027 19:3929761-3929783 ACTTAATACAAAAATTAGCCGGG - Intergenic
1162421857 19:10569977-10569999 ACTAAAAACACAAATTAGCCGGG - Intergenic
1162961642 19:14131343-14131365 ACTAAATACAAAAATTAGCCAGG - Intronic
1163514129 19:17752927-17752949 ACTTAATACAAAAATTATTCAGG + Intronic
1163570397 19:18078244-18078266 ACTAAATACAAAAATTAGCCAGG + Intronic
1164203948 19:23042298-23042320 ACTGAATACAAAATTTAGTCTGG + Intergenic
1164254958 19:23519558-23519580 ACTGAGTACACAATTTAGTCTGG + Intergenic
1164314704 19:24077101-24077123 ACTGAATACACAATTTAGCCTGG - Intronic
1165164925 19:33846058-33846080 ACTGAAAACAAAAATTAGCCGGG + Intergenic
1166548784 19:43651237-43651259 ACTAAAAATACAAATTAGTCGGG - Intronic
1167048095 19:47063131-47063153 ACTAAATACAAAAATTAGCCAGG - Intergenic
1167084425 19:47299626-47299648 ATAAAATACACAATTTAGCCAGG - Intronic
1168088684 19:54067268-54067290 AAAAAATACAAAATTTAGTCCGG + Intergenic
1168444655 19:56401573-56401595 ACTGAATACACAATTTAGTCTGG - Intronic
925272681 2:2624603-2624625 ACTAAAAACACAATTCGGTCTGG + Intergenic
925308115 2:2864538-2864560 ACTGAATACACAACTTAGTCTGG - Intergenic
925976322 2:9144569-9144591 ATTGAATACACAATTTACGTGGG + Intergenic
926208425 2:10850460-10850482 ACTGAATACACAGTTTACTCTGG - Intronic
926250166 2:11151061-11151083 AGTGAATTCACAATCTAGTCTGG - Intergenic
926521388 2:13919782-13919804 ACTGAATACACAATTTAGCCTGG - Intergenic
927995560 2:27483162-27483184 AATAAATACAAAAATTAGTCGGG - Intronic
928079756 2:28300097-28300119 TCAAAATACACAAATTAGTCCGG - Intronic
928517978 2:32062055-32062077 AAAGAATACAAAAATTAGTCGGG + Intergenic
929029960 2:37640845-37640867 ACTAAATACAAAAATTAGCCAGG + Intergenic
929701192 2:44164512-44164534 ACTAAATACAAAAATTAGCCAGG - Intergenic
929929863 2:46245421-46245443 CCTAAGTACACAATTTAGTGGGG + Intergenic
930786570 2:55277147-55277169 ACTAAATACAAAAATTAGCCAGG + Intergenic
931391385 2:61846999-61847021 ACTAAAAACAAAACTTAGTCGGG + Intronic
932727554 2:74192607-74192629 ACTGAATACACAATTTAGTCTGG + Intergenic
933613668 2:84462250-84462272 ACTGAATACACAATTTAGTCTGG - Intergenic
934510604 2:94938095-94938117 ACTAAATACAAAAATTAGCCAGG - Intergenic
934791540 2:97066513-97066535 ACTGAATACACAATTTAGTCTGG + Intergenic
934814898 2:97316030-97316052 ACTGAATACACAATTTAGTCTGG - Intergenic
934822797 2:97392453-97392475 ACTGAATACACAATTTAGTCTGG + Intergenic
934887055 2:98034121-98034143 AATGAATACACAATTTAGTCTGG - Intergenic
935280177 2:101510564-101510586 ACTGAATACACAACATACTCAGG + Intergenic
935983909 2:108653918-108653940 GATGAATACACAATTGTGTCTGG + Intronic
936115739 2:109701542-109701564 ACTGAATACGCAATTTAGTCTGG + Intergenic
936136342 2:109897572-109897594 GATGAATACACAATTGTGTCTGG + Intergenic
936208355 2:110473913-110473935 GATGAATACACAATTGTGTCTGG - Intergenic
939160651 2:138584585-138584607 ACTAAAAACACAAATTAGCCGGG + Intergenic
939171761 2:138704196-138704218 CCTGAGGACACATTTTAGTCAGG - Intronic
940999932 2:160191028-160191050 ACTAAATACAAATTTTATTCAGG + Intronic
941405563 2:165083416-165083438 TGTGAATACACAATTTAGTCTGG - Intergenic
942441363 2:176040220-176040242 ACACAACACACAATTTATTCCGG - Intergenic
943279513 2:185914100-185914122 ACATAATACAAAAATTAGTCGGG - Intergenic
943475083 2:188344165-188344187 AATCAAATCACAATTTAGTCAGG - Intronic
943598202 2:189882569-189882591 ATTGAATACACAATTTAATCTGG + Intronic
943686569 2:190824607-190824629 ACTAAATACAAAAATTAGCCAGG - Intergenic
945292897 2:208143439-208143461 ACTGAATACACAATTTAGTCTGG - Intronic
945883425 2:215350295-215350317 ACTAAATACAAAAATTAGCCAGG - Intergenic
946854405 2:223939013-223939035 ACTGAATACAGAAATTAGCCAGG - Intronic
947253875 2:228140103-228140125 ACAGAATACAAAAATTAGCCGGG - Intronic
947336832 2:229094908-229094930 AGTGAGGACACAATTTAGTATGG + Intronic
948380332 2:237546176-237546198 ACTGAACACACAATTTAGTCTGG + Intronic
1169455953 20:5752774-5752796 ACAAAATACAAAAATTAGTCAGG - Intronic
1169784770 20:9347811-9347833 ACTAAATACAAAAATTAGCCAGG + Intronic
1170548228 20:17453512-17453534 ACTGAATTTACAATTTAAGCTGG - Intronic
1170616200 20:17953896-17953918 ACTTAAAACAAAATTAAGTCAGG + Intronic
1171974425 20:31585328-31585350 ACTAAATACAAAAATTAGCCGGG - Intergenic
1172036633 20:32015431-32015453 CCTGAATACACAGTTTACTATGG - Intronic
1174661032 20:52213341-52213363 ACTAAATACACAATTTAGTCTGG + Intergenic
1175722607 20:61296409-61296431 ACAGAATACACACTTCAGGCAGG + Intronic
1176001695 20:62834801-62834823 ACTAAATACAAAAATTAGCCGGG - Intronic
1176192533 20:63819010-63819032 ACAGAATACAAAAATTAGCCAGG + Intronic
1176805858 21:13482580-13482602 AATAAATACACAATTTTATCAGG + Intergenic
1177035044 21:16032635-16032657 ACAAAATACAAAAGTTAGTCGGG + Intergenic
1177425005 21:20911371-20911393 AAAAAATACACAAATTAGTCAGG - Intergenic
1177649575 21:23942942-23942964 ACTGAAGACACAATTTAGTCTGG + Intergenic
1178067562 21:28922617-28922639 ACTGAATACACAATTTAGTCTGG - Intergenic
1178448278 21:32665485-32665507 ACTGAATACACAATTTAGTGTGG - Intronic
1178955349 21:37016991-37017013 ACTAAATACAAAAATTAGCCAGG + Intronic
1179104956 21:38391116-38391138 TCTGAAAAAACAATTAAGTCAGG - Intronic
1179668362 21:42927940-42927962 ACTGAATACACAATTGAGTCTGG + Intergenic
1180915935 22:19487129-19487151 ACTAAATACAAAAATTAGCCAGG + Intronic
1181267227 22:21637498-21637520 ACTAAATACAAAAATTAGCCAGG + Intergenic
1181515319 22:23407720-23407742 ACTGAATACACAATTTGGTCTGG + Intergenic
1181839123 22:25639731-25639753 ACTGAATCTACAAATTATTCTGG + Intronic
1182263980 22:29098017-29098039 ACTAAAAACAAAAATTAGTCAGG + Intronic
1182556182 22:31129702-31129724 ACTAAATACAAAAATTAGCCAGG - Intronic
1182588727 22:31362707-31362729 CCTGAATCCACAATTTAGTTTGG + Intergenic
1182942815 22:34294162-34294184 ATTGAACACAGAATTTTGTCAGG - Intergenic
1183607516 22:38874617-38874639 ACTAAATACAAAAATTAGCCGGG - Intergenic
1184323466 22:43762364-43762386 ACTGAATACACAAATTCACCAGG + Intronic
949493839 3:4613237-4613259 ACTAAATATACAATTTAGTCTGG + Intronic
951212343 3:19989169-19989191 ACTAAATACAAAAATTAGCCGGG + Intronic
951483982 3:23191698-23191720 CATGAATCCACAATTTGGTCAGG - Intergenic
952395687 3:32918683-32918705 ACTAAAAACACAAATTAGCCAGG + Intergenic
954001821 3:47563714-47563736 ACTGAAAATACAAGTTAGCCGGG - Intronic
954376761 3:50198554-50198576 ACTAAATACAAAAATTAGCCAGG - Intergenic
954557174 3:51527209-51527231 ACTAAATACAAAAATTAGCCGGG - Intergenic
956074916 3:65494839-65494861 ACTTAGTACACACTTTACTCAGG + Intronic
956552908 3:70481591-70481613 ATAGAATACACAGTTTAGTTAGG + Intergenic
956747009 3:72318297-72318319 AATAAATACACAAATTAGCCAGG + Intergenic
957684635 3:83485824-83485846 ACTGAAAAGACATTTTAGTGGGG + Intergenic
957764563 3:84605741-84605763 TCTGATTACATAATTTAGTCAGG - Intergenic
958038135 3:88193816-88193838 ACTGAATACATGACTTAGTCTGG - Intergenic
958149158 3:89668218-89668240 TAAGAATACACAAATTAGTCAGG + Intergenic
958780065 3:98530304-98530326 AAAGAATACAAAAATTAGTCGGG + Intronic
959021069 3:101187866-101187888 AAAGAATACAAAAATTAGTCGGG - Intergenic
960136193 3:114108104-114108126 ACTAAATACAAAAATTAGCCAGG + Intergenic
960318090 3:116202294-116202316 ACTAAATACAAAAATTAGCCAGG - Intronic
960712808 3:120547725-120547747 ACTGAATACACAACTTACTCTGG + Intergenic
961023698 3:123532673-123532695 ACTAAATACAAAAATTAGCCGGG + Intronic
961182807 3:124889264-124889286 ACTGAATACACAATTTAGTCTGG - Intronic
961218879 3:125184131-125184153 ACTAAATACAAAAATTAGCCAGG - Intronic
961565249 3:127759085-127759107 ACTAAATACAAAAATTAGCCAGG - Intronic
961620928 3:128224366-128224388 TTTGAATACAGAATTAAGTCTGG - Intronic
963082503 3:141407399-141407421 AATTAATACATAATTTGGTCAGG + Intronic
963299777 3:143585353-143585375 ACTGAATATACAATTTAGTCTGG - Intronic
963617583 3:147561705-147561727 ACTAAATACAAAAATTAGCCAGG - Intergenic
963892979 3:150656620-150656642 ACTGAATCCACATTTTACACGGG + Intergenic
964010940 3:151890863-151890885 ACTGTGTACACATATTAGTCTGG - Intergenic
964097230 3:152946441-152946463 AATGAATAAATAATTTAGCCAGG - Intergenic
965150782 3:164971965-164971987 GCTGAATACACCATTTATCCTGG - Intergenic
965647856 3:170902767-170902789 AATAAATACATAAATTAGTCAGG - Intronic
966163358 3:176990728-176990750 ACTAAATACAAAAATTAGCCCGG - Intergenic
966958226 3:184907244-184907266 ACTGAATACACAATTTAGTCTGG + Intronic
967708470 3:192679435-192679457 AAAGAATACAAAAATTAGTCAGG + Intronic
967761903 3:193235259-193235281 ACTAAATACAAAAATTAGCCAGG - Intergenic
967906496 3:194505437-194505459 ACTGAATTTGGAATTTAGTCTGG - Intergenic
967955666 3:194875659-194875681 ACTGAAAACACCATTTAATAAGG - Intergenic
968029966 3:195475098-195475120 ACAAAATACAAAATTTAGCCAGG + Intergenic
968270547 3:197399979-197400001 ACTGAATACACAATTTAGTCTGG - Intergenic
968362753 3:198159155-198159177 ACTGAATACACAATTTAGTCTGG + Intergenic
969655365 4:8494462-8494484 ACTGAATACACAACTTAGTCTGG - Intergenic
970271373 4:14351520-14351542 ACGGAATACACAGTTTAGTCTGG + Intergenic
970387840 4:15573912-15573934 ACTGAATATACAATTTGCTTAGG - Intronic
970573566 4:17405939-17405961 ACTAAATACAAAAATTAATCAGG + Intergenic
970762444 4:19507402-19507424 ACTAAATACAAAAATTAGCCGGG + Intergenic
970875118 4:20860298-20860320 ACTAAATACAAAAATTAGCCAGG - Intronic
971212828 4:24636436-24636458 AATAAATAAACAATTTATTCTGG + Intergenic
972235980 4:37134880-37134902 ACCAAATACAAAAATTAGTCTGG - Intergenic
972565623 4:40266582-40266604 ACTGAATACAAAATTTAGTCTGG + Intergenic
973911699 4:55588363-55588385 ACTGAATACACAATTTAGTCTGG - Intronic
973990438 4:56400893-56400915 ACTGTATAAACCATTTGGTCTGG + Exonic
974082802 4:57230325-57230347 ACTAAATACACAATTTAGTCTGG + Intergenic
974468195 4:62284912-62284934 ACTGAAAGCAAAATTCAGTCTGG - Intergenic
974609937 4:64204514-64204536 ACTGAATACACAATTTAGTCTGG - Intergenic
974651677 4:64762108-64762130 AATGAATACAGAATTTTTTCTGG - Intergenic
975394812 4:73862791-73862813 ACAGAATACACAATCCAGTATGG + Intergenic
976550880 4:86394106-86394128 ACTAAAAACACAAATTAGCCAGG + Intronic
977349000 4:95856572-95856594 ACTGAAGACACAATTTAGTCTGG + Intergenic
977837839 4:101665875-101665897 ACTAAAAACAAAATTTAGCCAGG - Intronic
977894316 4:102346297-102346319 ACTCAATAGACAGTTTAGTCTGG - Intronic
977958908 4:103062256-103062278 ACTAAATACAAAAATTAGCCGGG + Intronic
978263094 4:106786708-106786730 ACAGAATACACATTTTTCTCAGG - Intergenic
979209174 4:118078586-118078608 ACTAAATACAAAAATTAGTTGGG + Intronic
979858399 4:125663414-125663436 ACTAAATACACAATTTAGTTTGG + Intergenic
980914194 4:139019214-139019236 ACTAAATACAAAAATTAGCCCGG - Intronic
980983951 4:139677467-139677489 ACTGAATACACAATTTAGTCTGG + Intronic
981039836 4:140212918-140212940 ACGGAATACACAATTTAGTGTGG - Intergenic
981477312 4:145199842-145199864 ACTGAGTACACAATTTAGTCTGG + Intergenic
982004645 4:151051918-151051940 CCTGAAGAAACAATTTAGGCTGG - Intergenic
982056468 4:151554184-151554206 ATTGAATAGACAATTTAGTGTGG + Intronic
983072749 4:163289442-163289464 ACAGAATTCACTATTTGGTCAGG - Intergenic
983235744 4:165177566-165177588 ACTGAATTCCCAATTCAGTAGGG - Intronic
983384872 4:167047883-167047905 ACACAATACAAAATTTAGCCAGG + Intronic
983583723 4:169334437-169334459 ACTGAATACACAATTTAGTCTGG - Intergenic
983639862 4:169935143-169935165 ACTGAAAACACAATTTAGTCTGG - Intergenic
983804788 4:171981277-171981299 ACCAAATGCACAATTTAGACTGG + Intronic
984679867 4:182594878-182594900 ACTGAATACAAAAATTAGCTGGG - Intronic
985182593 4:187281170-187281192 GTTAAATACACAATTTATTCTGG + Intergenic
985953281 5:3239385-3239407 AATCAATACAAAATTTAGCCAGG - Intergenic
986092847 5:4527382-4527404 AATAAATACACAAATTAGCCAGG + Intergenic
986163658 5:5253400-5253422 ACTGAATACACTATTTAGTCTGG + Intronic
986636997 5:9833088-9833110 ACTGAATACACAGTTTAGTCTGG + Intergenic
986781590 5:11071375-11071397 TATGAATACAAAAATTAGTCAGG + Intronic
987227515 5:15858902-15858924 AATTAATACACAATATGGTCTGG + Intronic
987627757 5:20424586-20424608 ACTAAATACAAAAATTAGCCAGG + Intronic
989591301 5:43115445-43115467 ACTAAATACAAAAATTAGCCGGG - Intronic
989629803 5:43470002-43470024 AATGAATACACAATTTTATCTGG - Intronic
990485115 5:56250648-56250670 ACTAAATACAAAAATTAGCCAGG - Intergenic
990695259 5:58409241-58409263 ACTGAATACACAATTTAGTCTGG - Intergenic
991175714 5:63685680-63685702 ACTGAATATACAATTTAGTCTGG - Intergenic
991264910 5:64706281-64706303 ACTAAATACACAATTTAGTCTGG + Intronic
991938271 5:71825144-71825166 AAAAAATACACAAATTAGTCAGG - Intergenic
992468653 5:77031741-77031763 ACTAAATACAAAAATTAGCCGGG + Intronic
992815552 5:80433963-80433985 AAGGAATATACAATTTAGTTGGG - Intronic
992826116 5:80551901-80551923 ACTGATTAAATAATGTAGTCAGG + Intergenic
992937481 5:81724211-81724233 ACTGAATACACAAATTAATTTGG + Intronic
994255991 5:97596721-97596743 ACTGAATCTATAAATTAGTCTGG - Intergenic
997417449 5:133740041-133740063 AAAAAATACAAAATTTAGTCAGG - Intergenic
998272634 5:140720658-140720680 AATAAATACAAAATTTAGCCAGG - Intergenic
998392496 5:141796237-141796259 ACTGAGTACAAAAATTAGCCGGG - Intergenic
998470079 5:142376789-142376811 ACTGAAAATACAAATTAGCCGGG + Intergenic
998681202 5:144469347-144469369 ACTGAATACACATTTTCCTGAGG + Intronic
999450429 5:151673607-151673629 CCTGAATACACAATTTAATCTGG - Intronic
1000238175 5:159383151-159383173 ACTAAAAACACAAGTTAGCCGGG + Intergenic
1002148295 5:177204512-177204534 ACTAAATACAAAAGTTAGCCAGG - Intronic
1002154220 5:177262946-177262968 ACTGAATACACAATTTAATCTGG - Intronic
1002179797 5:177425389-177425411 CCTGAACACACCACTTAGTCTGG + Intronic
1002358828 5:178653569-178653591 ACTGAAAATACAAATTAGCCAGG - Intergenic
1002359392 5:178658732-178658754 ACTGGATCCAGAATTTAGCCAGG + Intergenic
1003001491 6:2338922-2338944 ACTGAATACACAATTTAGTCTGG + Intergenic
1003036259 6:2642861-2642883 AAAAAATACACAAATTAGTCAGG + Intergenic
1003729985 6:8810536-8810558 CCTTCATACACAATTTAGCCAGG - Intergenic
1003959176 6:11193140-11193162 ACAAAATACAAAAATTAGTCAGG + Intronic
1005139081 6:22606576-22606598 ACTGAATTCTCAATTCAGGCTGG + Intergenic
1005615466 6:27568348-27568370 GCTGAAAACACAATTTAGTCTGG - Intergenic
1005621625 6:27625758-27625780 ACTGAATACACAATTTACCTGGG + Intergenic
1005624342 6:27649248-27649270 ACTGAATACACAATTTAGTCTGG - Intergenic
1005833607 6:29690624-29690646 ACTGAAAATACAAATTAGGCAGG - Intergenic
1006540478 6:34736032-34736054 ACTGAAAATACAAATTAGCCGGG + Intergenic
1007156336 6:39748291-39748313 ACTGAACACCTAATTTAGTCTGG + Intergenic
1007340348 6:41187346-41187368 ACTGAACACACAATTTAGTCTGG + Intergenic
1008114668 6:47534542-47534564 ACTAAATATACAAATTAGCCGGG + Intronic
1008553154 6:52652569-52652591 AGTGAGTACACAATCTAGTTAGG + Intergenic
1008650368 6:53555276-53555298 ACCGAATACACAATTTAGTCTGG - Intronic
1009747847 6:67842337-67842359 AATGAATACACAATATAATAAGG + Intergenic
1010622155 6:78090010-78090032 ACTGAATACGCAATTTATTCTGG - Intergenic
1013089328 6:106885465-106885487 ACTAAAAACACAAATTAGCCGGG - Intergenic
1013427865 6:110031372-110031394 ACTGAGTACACAATCTGGTTTGG + Intergenic
1014434464 6:121405966-121405988 ACTGACTACACAATTTATTCTGG - Intergenic
1014726839 6:124981543-124981565 ACTGAATATACAATTTAGTCTGG + Intronic
1014930714 6:127332673-127332695 ACTGAATACACAATTTAGTCTGG + Intronic
1014987324 6:128027753-128027775 ACTAAAAACAAAAATTAGTCAGG - Intronic
1014991094 6:128077898-128077920 ACTGAACATTCAATTTACTCTGG + Intronic
1015189267 6:130455548-130455570 ACTAAATACACAATTTAGCTGGG + Intergenic
1015503879 6:133961626-133961648 ACTAAATACAAAAACTAGTCGGG - Intronic
1015524753 6:134165518-134165540 AATGAATAAAGAATTTAGTGTGG - Intergenic
1015766076 6:136718362-136718384 ACTAAATACAAAAATTAGCCAGG - Intronic
1015962374 6:138663396-138663418 ACTAAAAACACAAATTAGCCAGG + Intronic
1016351422 6:143173214-143173236 ACACAATACACAAATTAGACAGG - Intronic
1017129662 6:151097141-151097163 AATGAACACACAATAAAGTCTGG + Intronic
1017182529 6:151567079-151567101 ACTGAAAATACAAATTAGTTGGG - Intronic
1017443294 6:154484539-154484561 ACTAAATACAAAAATTAGCCGGG + Intronic
1017742007 6:157414861-157414883 ACAGAATTCACAATTTCATCAGG - Intronic
1017947996 6:159111429-159111451 GCTGTATATACAATTTAGTTGGG - Intergenic
1019233306 6:170586499-170586521 ACTGAATACACAATTTAGTCTGG + Intergenic
1019252930 7:29556-29578 ACTGAATACACAATTTAGTCTGG - Intergenic
1019484498 7:1283202-1283224 ACTAAATACAAAAATTAGCCGGG - Intergenic
1021074749 7:16288547-16288569 ACTGAAAACACAATACAGGCTGG + Intronic
1021648631 7:22811090-22811112 CCTGAATACACAATTTAGTCTGG - Intergenic
1021657621 7:22887663-22887685 ACTGAAAATACAAATTAGCCGGG + Intergenic
1022381425 7:29863913-29863935 ACTGATAAGTCAATTTAGTCAGG - Intronic
1023296912 7:38724752-38724774 ACTAAAAACACAAATTAGCCAGG - Exonic
1023417201 7:39944698-39944720 ACTAAATACAAAATTTAACCAGG - Intergenic
1023736009 7:43236628-43236650 GCTGAATACTCAATGTAGTCTGG + Intronic
1023934058 7:44726559-44726581 ACTGAATACACAATTTAGTCTGG + Intergenic
1024589839 7:50871788-50871810 CCTGAATACACAGTTTAGCCTGG + Intergenic
1024624414 7:51192443-51192465 ACTAAATACACAAATTAGCCGGG + Intronic
1025957686 7:66195387-66195409 ACTAAATACAAAAATTAGCCAGG + Intergenic
1026561865 7:71457017-71457039 ACTGAATACACAATTTAGTCTGG + Intronic
1026638484 7:72104660-72104682 AAATAATACACAATTTAGGCCGG + Intronic
1026872511 7:73861607-73861629 ACAAAATACAAAAATTAGTCAGG - Intronic
1027389244 7:77689098-77689120 ATTGAATACAAAAATTAGCCGGG + Intergenic
1027517702 7:79163334-79163356 ACTAAATACAAAAATTAGCCAGG - Intronic
1028340654 7:89715868-89715890 AGGGGATTCACAATTTAGTCTGG - Intergenic
1029304766 7:99610923-99610945 ACAGAATACAGAATATACTCGGG + Intergenic
1029613569 7:101641874-101641896 ACTAAATACAAAAATTAGCCGGG + Intergenic
1030421909 7:109317562-109317584 AAATAATACACAAATTAGTCGGG + Intergenic
1030435226 7:109509465-109509487 ACTGCATACACATTTTTGCCTGG + Intergenic
1030512936 7:110506992-110507014 ACTGTAGACACACTTTAGTAAGG - Intergenic
1031197970 7:118640732-118640754 ACTGAATATACAATTTAGTCTGG - Intergenic
1031359607 7:120832711-120832733 ACTCAATACACAATTAAGGAGGG + Intronic
1031503332 7:122549458-122549480 AATTAATACAAAATTTAGCCAGG + Intronic
1031621701 7:123941469-123941491 ATTGAATATACAATTTAGTCTGG + Intronic
1031622129 7:123946743-123946765 ACTGCATACAAAATTTAGTCTGG + Intronic
1032028801 7:128464480-128464502 ACTAAATACAAAAATTAGTCGGG + Intergenic
1032031924 7:128491431-128491453 ACTAAATACAAAAATTAGCCAGG + Intronic
1032801306 7:135319272-135319294 ACTGAATACATAATTTAGTTTGG - Intergenic
1034332030 7:150291266-150291288 ACTAAAAATACAAATTAGTCAGG + Intronic
1034666005 7:152818609-152818631 ACTAAAAATACAAATTAGTCAGG - Intronic
1035337733 7:158140882-158140904 ACTGAATACAAAAGAAAGTCAGG - Intronic
1035380735 7:158439021-158439043 AGTGAATACACAATTGAGCCTGG - Intronic
1035950775 8:4018318-4018340 AATGAATACACATTTAAGCCAGG - Intronic
1036486415 8:9183582-9183604 ACTGAATACACAACGTAGTCTGG + Intergenic
1037014907 8:13892116-13892138 CCTGACTTCAAAATTTAGTCAGG - Intergenic
1038979323 8:32739953-32739975 ACTGAATACATCATTAATTCTGG + Intronic
1039290756 8:36092005-36092027 ACTGAATACACAATTTAGTTTGG + Intergenic
1039761713 8:40583855-40583877 ACTAAATACAGAATTTAGTCTGG + Intronic
1039952987 8:42186374-42186396 ACTGAACACACAATTGAGTCTGG - Intronic
1040778569 8:51077329-51077351 ACTAAATACAAAAGTTAGCCAGG + Intergenic
1040913573 8:52545402-52545424 ACTGAGTACACAATTTAGTGTGG - Intronic
1040925635 8:52679451-52679473 ACTCAATACATAATTTAGTCTGG - Intronic
1041491393 8:58437486-58437508 ACTAAATACAAAAATTAGCCAGG - Intronic
1042271291 8:66958498-66958520 ACTAAATACAAAAATTAGCCAGG + Intronic
1043039913 8:75250258-75250280 AAAGCATACACAATTTAGTCAGG - Intergenic
1043577350 8:81673287-81673309 TTTAAATACACAATTGAGTCTGG - Intronic
1044057377 8:87587900-87587922 CCTGAATACACAATTGAGTCTGG + Intronic
1044467120 8:92520439-92520461 ACTGGATAGAAAATTTAGACAGG - Intergenic
1045092196 8:98757339-98757361 ACTAAATACAAAAATTAGCCGGG - Intronic
1047091868 8:121583969-121583991 GCTGAATACACAATTCAGTCTGG - Intergenic
1047110987 8:121789389-121789411 ACTGAACACACCATTTAGTCTGG - Intergenic
1047136084 8:122079875-122079897 ACTGAATACACAATTTAGTCTGG + Intergenic
1048892668 8:138961762-138961784 ACTGAATACACAATTTAGTCTGG - Intergenic
1049711793 8:144067843-144067865 ACTAAATACATAAATTAGCCGGG + Intergenic
1049909064 9:247867-247889 ACTATAAACAGAATTTAGTCTGG - Intronic
1050942328 9:11475540-11475562 ACTAAAAATACAAATTAGTCAGG - Intergenic
1051036515 9:12753565-12753587 ACAAAATACAAAAATTAGTCAGG - Intergenic
1051876218 9:21796577-21796599 ACTGCATACACAATTTAGTCTGG + Intergenic
1052832005 9:33223329-33223351 ACTAAAAACACAAATTAGCCGGG - Intronic
1053060583 9:35027955-35027977 ACTGAATACACAATTTAGTCTGG + Intergenic
1053536411 9:38930901-38930923 ACTAACTACACAATTTAGTCTGG + Intergenic
1053564087 9:39229212-39229234 TCTGAATAGAAATTTTAGTCAGG + Intronic
1053829876 9:42067095-42067117 TCTGAATAGAAACTTTAGTCAGG + Intronic
1054133061 9:61389822-61389844 TCTGAATAGAAATTTTAGTCAGG - Intergenic
1054600682 9:67120358-67120380 TCTGAATAGAAACTTTAGTCAGG - Intergenic
1054629723 9:67433047-67433069 ACTAACTACACAATTTAGTCTGG - Intergenic
1055054460 9:72010942-72010964 ATCAAATACACAATTTAATCTGG + Intergenic
1055265032 9:74485527-74485549 ACTAAATACAAAAATTAGCCGGG + Intergenic
1056058196 9:82851727-82851749 ACTGAAAATACAATTTAGACTGG - Intergenic
1057824127 9:98359265-98359287 TAAGAATACAAAATTTAGTCAGG + Intronic
1058362198 9:104161805-104161827 AAAGAATACACAAATTAGCCAGG - Intergenic
1059898276 9:118892933-118892955 ACAAAATACACAGTTAAGTCAGG + Intergenic
1061351913 9:130072127-130072149 ACTAAATACAAAAATTAGCCAGG - Intronic
1061551675 9:131338474-131338496 ACTAAATACAAAAATTAGCCAGG + Intergenic
1062747440 9:138222818-138222840 ACTGAATACACAATTTAGTCTGG + Intergenic
1185617155 X:1429055-1429077 ACTAAATACAAAAATTAGCCGGG - Intronic
1185723045 X:2397157-2397179 ACTAAATAAAAAAATTAGTCAGG - Intronic
1185804949 X:3048474-3048496 ACTGAATACACAATTTAGGCTGG - Intronic
1185917201 X:4048525-4048547 ACTGAATACATAATTTATTCTGG + Intergenic
1186202220 X:7166166-7166188 AAAGAATACAAAAATTAGTCAGG - Intergenic
1187657128 X:21489019-21489041 ACTGAATACAAAATTTAGTCTGG - Intronic
1188019756 X:25144297-25144319 ACTGAAAACATAATTTAGATGGG - Intergenic
1188430677 X:30103267-30103289 ATTGAATACACAATTTAGTCTGG + Intergenic
1188528508 X:31112074-31112096 ACTGCATTCAGAATTTAGCCAGG + Intronic
1188560652 X:31465179-31465201 ATTGAATAAATAATTTGGTCAGG + Intronic
1188660697 X:32754388-32754410 ATAGAATACACATTTTAGTCAGG - Intronic
1190951803 X:55152960-55152982 ACTGAATATACAATTTAGTCTGG - Intronic
1191021853 X:55868759-55868781 ACTTAATACACAATTTAGTCTGG + Intergenic
1191920342 X:66249541-66249563 ACTGAGGACACAATTGAGACTGG + Intronic
1192111812 X:68372647-68372669 ACCGAAGACACAACTTAGTTTGG - Intronic
1192419198 X:71013922-71013944 ACTAAATACAAAAATTAGCCAGG + Intergenic
1192741674 X:73899354-73899376 ACAAAATACAAAAATTAGTCAGG + Intergenic
1193179651 X:78439827-78439849 ACTGAATATGTAATTAAGTCTGG - Intergenic
1193213810 X:78839341-78839363 ACTGAATACACAATTTAGTCTGG - Intergenic
1193319710 X:80107010-80107032 ACAGAATACACAATTTAGTGTGG - Intergenic
1193345893 X:80404080-80404102 ACTGAATACACAATTTCGTCTGG + Intronic
1193346966 X:80414688-80414710 ACTGAATACATAATTTAATCTGG + Intronic
1194113868 X:89872524-89872546 ACTGAATACACAATTTAGCCTGG + Intergenic
1194173625 X:90619878-90619900 GCAGAATACACATTTTTGTCAGG + Intergenic
1194485405 X:94479960-94479982 ACTGAATACACAATTTAGTCTGG - Intergenic
1194487162 X:94498493-94498515 ATTGAATACAGAATTCAGTCTGG - Intergenic
1194502364 X:94697482-94697504 ACTGAATACGCAATTTAGTCTGG + Intergenic
1194654875 X:96560423-96560445 ACTAAATACAAAAATTAGCCAGG - Intergenic
1196456863 X:115897004-115897026 ACTGAATACACAATGTAGTCTGG - Intergenic
1197483309 X:127014428-127014450 ACTGAATACTCCATTAAGGCAGG - Intergenic
1198853825 X:140995218-140995240 AGTGAATACACAATTTAGCCTGG - Intergenic
1199174948 X:144776474-144776496 ACTGCTTACACAATTTAGCCTGG + Intergenic
1199211145 X:145212146-145212168 ACAAAATACAAAAATTAGTCGGG - Intergenic
1199746833 X:150777042-150777064 ACTGAATACACAATTTTGTCTGG + Intronic
1200412346 Y:2873219-2873241 AATAAATACAAAATTTAGCCAGG - Intronic
1200466606 Y:3527879-3527901 ACTGAATACACAATTTGGCCTGG + Intergenic
1200519846 Y:4197566-4197588 GCAGAATACACATTTTTGTCAGG + Intergenic
1201276307 Y:12302133-12302155 ACTGAATGCACAATTTAGGCTGG + Intergenic
1201389484 Y:13481470-13481492 ACTGAATACAGAATTTAGTCCGG + Intergenic
1201865845 Y:18653367-18653389 ACTAAACACAAAAATTAGTCAGG + Intergenic