ID: 1193213813

View in Genome Browser
Species Human (GRCh38)
Location X:78839357-78839379
Sequence ATTCAGTGGAAGGCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193213808_1193213813 28 Left 1193213808 X:78839306-78839328 CCCTATTGTTTATGTAAAAATGT No data
Right 1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG No data
1193213810_1193213813 -7 Left 1193213810 X:78839341-78839363 CCAGACTAAATTGTGTATTCAGT 0: 41
1: 63
2: 47
3: 40
4: 372
Right 1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG No data
1193213809_1193213813 27 Left 1193213809 X:78839307-78839329 CCTATTGTTTATGTAAAAATGTA No data
Right 1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193213813 Original CRISPR ATTCAGTGGAAGGCTGATGA AGG Intergenic
No off target data available for this crispr