ID: 1193224129

View in Genome Browser
Species Human (GRCh38)
Location X:78961498-78961520
Sequence CACTCTCCTTGCTCATGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193224129_1193224132 -7 Left 1193224129 X:78961498-78961520 CCGCCTCATGAGCAAGGAGAGTG 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1193224132 X:78961514-78961536 GAGAGTGGTTCATCAATGATTGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193224129 Original CRISPR CACTCTCCTTGCTCATGAGG CGG (reversed) Exonic
901104405 1:6744021-6744043 CACAGTCATTACTCATGAGGAGG + Intergenic
902849009 1:19138598-19138620 CAGTCTACTAGCTGATGAGGTGG - Intronic
905475207 1:38221491-38221513 CAGTCTCCTGGTTCATTAGGAGG - Intergenic
908406794 1:63822121-63822143 CACTGTGCTTGCTGATGTGGGGG + Intronic
909827991 1:80150041-80150063 CACACTCCATGCTCATGGAGGGG - Intergenic
913077096 1:115349725-115349747 CACACTCCTTGCACATATGGAGG + Intergenic
914017589 1:143834480-143834502 TACTCTCGTTGCTGGTGAGGAGG - Intergenic
914656200 1:149743012-149743034 TACTCTCGTTGCTGGTGAGGAGG - Intergenic
916677212 1:167074185-167074207 GACTCTCCTCCCTCAGGAGGTGG + Intronic
918374531 1:183895900-183895922 CTCTCTCCTATCTAATGAGGAGG + Intronic
918395718 1:184111277-184111299 AACTCTGCTTTCTCAGGAGGGGG - Intergenic
1064025539 10:11845824-11845846 CACTCTCCTGCCTCAGGAGCAGG - Intronic
1065261831 10:23931687-23931709 CACTTTCCTTTCTCATGGGTGGG + Intronic
1066067838 10:31775044-31775066 CTCTCTCCTTGCTCCAGAGTGGG - Intergenic
1067090880 10:43265413-43265435 CACACTCCCTGCTCCTGAGAAGG - Intronic
1067947108 10:50696534-50696556 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1069923230 10:71830287-71830309 GACTGGACTTGCTCATGAGGGGG - Intronic
1070882420 10:79861524-79861546 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1071648990 10:87377835-87377857 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1076713319 10:132350952-132350974 CCCTCTCCCTGCCCATGAGAGGG - Intronic
1076826227 10:132971019-132971041 CTCCCTCCATGCTCAGGAGGAGG + Intergenic
1079131592 11:17749974-17749996 CACTCCCCTTGCACTTGAGATGG - Intronic
1082750485 11:57009777-57009799 CAATATACTTGCTGATGAGGAGG + Intergenic
1084851462 11:71944620-71944642 CACTGTCCGTGCTCCTGTGGAGG + Intronic
1090255549 11:125281205-125281227 CAATCTCTTTCCTCCTGAGGTGG - Intronic
1093293890 12:17364157-17364179 CATTGTCCCTGCTCTTGAGGAGG + Intergenic
1097307649 12:58087122-58087144 AACTCTCCTGGCTTCTGAGGAGG + Intergenic
1099310188 12:81010576-81010598 CACTCTCCTTGATTTTGTGGAGG + Intronic
1100291144 12:93215901-93215923 CAGTTTCCCTGCTAATGAGGGGG - Intergenic
1107115322 13:36740399-36740421 CACTCTCCTTGCACACATGGGGG - Intergenic
1110518302 13:76443245-76443267 AACACCCCTTGCTCATGAGCTGG + Intergenic
1112157460 13:96833206-96833228 CCCTCTCCTCTCTCAGGAGGGGG + Exonic
1117212690 14:53517542-53517564 CACACACCTTGCACAGGAGGTGG - Intergenic
1117401026 14:55358617-55358639 CAAACTCCTTGCCCATGAAGAGG + Intronic
1118761300 14:68881811-68881833 CAGGCTCATTGCTCAGGAGGAGG + Intronic
1119476913 14:74935570-74935592 CTCTCTCCATCCTCAAGAGGAGG + Intergenic
1120859403 14:89241365-89241387 CTCTGTGCATGCTCATGAGGTGG + Intronic
1121528341 14:94635023-94635045 CACTCTCCTAGCTGAGGATGGGG + Intergenic
1123165377 14:106320513-106320535 CACTCTCCTTCCTGGTGAGAAGG - Intergenic
1123991154 15:25684366-25684388 CGCTTTCCTTGCTCATGACATGG + Intronic
1127638902 15:60896922-60896944 AAATTTCCTTTCTCATGAGGTGG + Intronic
1127761952 15:62148239-62148261 CACTCTTCTTTCCAATGAGGAGG + Intergenic
1131014396 15:89045521-89045543 AACACTCCATGCTCATGAGTAGG - Intergenic
1131117561 15:89804261-89804283 CACTGTGATTGCTCATGAGCTGG - Exonic
1131460327 15:92613257-92613279 CACCCAGCTTGCCCATGAGGCGG - Intergenic
1133284044 16:4682459-4682481 CACCCTCCATGCCCACGAGGAGG + Intronic
1135385451 16:22035473-22035495 CACTCTCCTTGCTCAAGCCTGGG + Intronic
1138133329 16:54500677-54500699 CAATCTCCTTGCCTATGGGGAGG + Intergenic
1139546099 16:67650281-67650303 CCCTCTCCTTGATCTGGAGGCGG + Intronic
1142127113 16:88415649-88415671 CGCTCTCCCTGCTCCTGAGCAGG - Intergenic
1143902450 17:10184307-10184329 GAGTTTCCTTGATCATGAGGTGG - Intronic
1144575576 17:16427532-16427554 CACTCACCTGGCCCACGAGGAGG - Exonic
1146403475 17:32518586-32518608 GACTGTGGTTGCTCATGAGGAGG - Intronic
1146649179 17:34596221-34596243 CACACTCCTTGGTCATGGTGGGG - Intronic
1147336361 17:39728917-39728939 CACTCTCCTCACTCACAAGGAGG - Intronic
1148966653 17:51441458-51441480 CTCTCTCCTTGATGAAGAGGTGG + Intergenic
1151383852 17:73743307-73743329 AACTCTCATTACTCATGAGCCGG - Intergenic
1155038544 18:22045633-22045655 CAGTGTCCTTGCTCTAGAGGAGG + Intergenic
1157465883 18:47944629-47944651 CAATTTCCTTGCTCTTGAGAGGG + Intergenic
1160053882 18:75461644-75461666 CTCTCTCCTTTGCCATGAGGAGG - Intergenic
1164797629 19:31046986-31047008 CACTCTGCTTGCTGATGAACTGG + Intergenic
1164896657 19:31882866-31882888 CCTTCTCCTTGCTCACCAGGTGG + Intergenic
1165973621 19:39655447-39655469 CACTGACCTTGATCCTGAGGAGG - Intergenic
928658396 2:33476457-33476479 CGCTCTGCATGCTCATGAGATGG + Exonic
936256857 2:110923472-110923494 TACTCTCCTTGCACTTGAGTAGG - Intronic
940987202 2:160062056-160062078 CACCCTCCTGGCTCCTGCGGGGG - Intronic
942047169 2:172106479-172106501 CACTCTCCTTCCTCACTCGGGGG + Intergenic
944101929 2:196036582-196036604 CAGTGTCCCTGCTGATGAGGGGG - Intronic
944114800 2:196174359-196174381 CACTTTCCTTGATCATTATGTGG - Intronic
945366662 2:208963140-208963162 AACATTCCTTGCTCATGAGTAGG + Intergenic
946339864 2:219060146-219060168 CGCTCACCTGGGTCATGAGGCGG + Exonic
948778215 2:240300979-240301001 CATACTCCTTGTTCATGAAGTGG - Intergenic
948878611 2:240843650-240843672 GAGTCTCCTTGGTCAAGAGGGGG - Intergenic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG + Intronic
1173213636 20:41058567-41058589 CTCTCTCCTTGCTCTGGGGGAGG - Intronic
1174970566 20:55270795-55270817 CATTCTCTCTGCTCATTAGGAGG + Intergenic
1176627456 21:9105267-9105289 CACTCTCTTTGCTCATCCGTGGG - Intergenic
1177151448 21:17459228-17459250 CAAGCACCTTCCTCATGAGGTGG + Intergenic
1179979126 21:44887400-44887422 CAGTCCCCATGCTCAGGAGGTGG - Intronic
1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG + Intronic
1180786314 22:18549698-18549720 CTCCCTTCTTCCTCATGAGGTGG + Intergenic
1181131595 22:20735424-20735446 CTCCCTTCTTCCTCATGAGGTGG + Intronic
1181243235 22:21489251-21489273 CTCCCTTCTTCCTCATGAGGTGG + Intergenic
1184069930 22:42141383-42141405 CACTCTCCTTCCTCCTGTGTTGG + Intergenic
1184857168 22:47152628-47152650 GGCTCTCCTTGCTTATGAGATGG + Intronic
949491392 3:4592837-4592859 CAATCTCCTTGCTCCAAAGGTGG - Intronic
960936392 3:122906500-122906522 CACACTGCTTGCAGATGAGGTGG - Intergenic
961640126 3:128359986-128360008 CATTGCCCTTGCTCATGAGAAGG - Intronic
964295612 3:155229881-155229903 CACTCACCTGGCACATGAGATGG + Intergenic
965762139 3:172090554-172090576 CACTTTCCTTGCTCATGGAGTGG + Intronic
971049493 4:22844997-22845019 CACTCCCCTTGAGCATGAGCTGG - Intergenic
971946341 4:33283639-33283661 CTCTCTCCTTGATAATGTGGTGG - Intergenic
975270201 4:72422694-72422716 CACACTCCTTACTCACTAGGAGG + Intronic
975791134 4:77952421-77952443 TACTTTATTTGCTCATGAGGTGG + Intronic
980140867 4:128914963-128914985 TACTCTGCTTGCTCATAAAGGGG + Intronic
982676063 4:158377070-158377092 CACTTGCCTTGGTCATTAGGGGG - Intronic
984861568 4:184244879-184244901 AAATCTCCTTTTTCATGAGGGGG + Intergenic
987901416 5:24017262-24017284 CACTCTCCATGCTCATGCACAGG - Intronic
991626177 5:68603301-68603323 CATTCTCCTGCCTCAAGAGGAGG + Intergenic
992324663 5:75648917-75648939 CACTCCCCTTGATGATGGGGAGG - Intronic
1000142769 5:158422540-158422562 AACTCTCCATCCTCATGAGGGGG + Intergenic
1000168304 5:158677102-158677124 CAATCTCCTTGCCCAGGAGCTGG + Intergenic
1001240672 5:170067619-170067641 CACTCTCCATGCTCCTGAACGGG + Exonic
1004050891 6:12077796-12077818 CCCTCTTCTTACTCAAGAGGGGG + Intronic
1007761609 6:44136547-44136569 CACTTTCTTTGCTGAGGAGGAGG - Intronic
1009538855 6:64925489-64925511 CACCACCCTTGCTCATTAGGAGG - Intronic
1009706398 6:67257793-67257815 CACTCTTCTTGAATATGAGGTGG + Intergenic
1010840605 6:80645505-80645527 CACACTCCATGCTCATGAATGGG + Intergenic
1010924977 6:81734072-81734094 CACTCGTCTATCTCATGAGGTGG - Intronic
1016397389 6:143639643-143639665 CGCTATCCTTACTCATGATGGGG - Intronic
1017918562 6:158852528-158852550 CACTCTCCTTGATCTTGTGCTGG + Intergenic
1018599430 6:165524117-165524139 GACTCTCCTTGCTCCTCAGCCGG + Intronic
1020920107 7:14252822-14252844 CACTCTTCTTTCCCATGTGGAGG + Intronic
1021876599 7:25055103-25055125 CAGTCACCTTGCACATGAGGTGG + Intergenic
1022189729 7:28005694-28005716 CATTCTACTTGCTAATGAGTAGG + Intronic
1028950112 7:96625054-96625076 AACTCCCCCTGCTCATAAGGAGG + Intronic
1029454024 7:100658330-100658352 CACTCTCCCAGCTCCTGAGTCGG - Intergenic
1029880660 7:103806276-103806298 CATTATCCTTGCTATTGAGGGGG + Intronic
1030152410 7:106420559-106420581 CACTCACCTTCCTCACAAGGTGG + Intergenic
1030187609 7:106778935-106778957 CACATACCTTGCTCATGAGAGGG - Intergenic
1033491622 7:141849310-141849332 AACTCTTCTTGCTCTTCAGGGGG + Intergenic
1034534052 7:151715872-151715894 CACTCTCCTCGCTCACAGGGCGG + Intronic
1034914167 7:155023180-155023202 CACTCACCTGGCCCAGGAGGTGG - Intergenic
1035948345 8:3990772-3990794 CCCTCTCCTTCCTCATGAAAGGG - Intronic
1036494975 8:9262037-9262059 CCCTCTCCCTTCTCATGTGGAGG - Intergenic
1039341510 8:36655555-36655577 CTCTCTCCTTGATCATGAGATGG + Intergenic
1042227167 8:66522942-66522964 CCCACTCCTTGCTCCTGAGATGG - Intergenic
1044502256 8:92971667-92971689 CATTCTCCATGCTCATGAATAGG + Intronic
1049022438 8:139966663-139966685 CTCTCTCCCTGCTCTTGAGAAGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1056575912 9:87856155-87856177 CAGCCTCCTTTCTCATTAGGTGG + Intergenic
1057072012 9:92106752-92106774 CAGCCTCCTTTCTCATTAGGTGG - Intronic
1057640247 9:96812797-96812819 CACTCTTTTTGCCCATGATGGGG + Intergenic
1062304272 9:135894185-135894207 CACTCTCCTTCCCCATCAGGCGG + Intronic
1188158784 X:26775362-26775384 CACTTTCCTTCCTCAAGATGTGG - Intergenic
1191017214 X:55821679-55821701 AACTTTCCATGCTCATGAGTAGG - Intergenic
1193224129 X:78961498-78961520 CACTCTCCTTGCTCATGAGGCGG - Exonic
1194759038 X:97772136-97772158 CACTATCCTTCCTCCTGTGGGGG - Intergenic
1196847144 X:119905294-119905316 CACTCACCGTTCTCATTAGGAGG + Intronic
1198890413 X:141388759-141388781 CCCTCTCTTTGCTAATGAGTAGG + Intergenic
1199002105 X:142651141-142651163 CTCTCTCCTTCCTCAAGAGAAGG + Intergenic
1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG + Exonic