ID: 1193230508

View in Genome Browser
Species Human (GRCh38)
Location X:79039626-79039648
Sequence GCATAGTACTTGTACAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193230508_1193230511 19 Left 1193230508 X:79039626-79039648 CCTGTTTTGTACAAGTACTATGC No data
Right 1193230511 X:79039668-79039690 TTGTAGTATAGTTTGAAGTCTGG 0: 13048
1: 7611
2: 6134
3: 4840
4: 3817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193230508 Original CRISPR GCATAGTACTTGTACAAAAC AGG (reversed) Intergenic
No off target data available for this crispr