ID: 1193237029

View in Genome Browser
Species Human (GRCh38)
Location X:79119963-79119985
Sequence CTTGATACCAAAATCAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193237029_1193237034 10 Left 1193237029 X:79119963-79119985 CCTTGTTTGATTTTGGTATCAAG No data
Right 1193237034 X:79119996-79120018 TTTCATAGAATGAGTTGGGCAGG No data
1193237029_1193237033 6 Left 1193237029 X:79119963-79119985 CCTTGTTTGATTTTGGTATCAAG No data
Right 1193237033 X:79119992-79120014 CCGATTTCATAGAATGAGTTGGG No data
1193237029_1193237031 5 Left 1193237029 X:79119963-79119985 CCTTGTTTGATTTTGGTATCAAG No data
Right 1193237031 X:79119991-79120013 ACCGATTTCATAGAATGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193237029 Original CRISPR CTTGATACCAAAATCAAACA AGG (reversed) Intergenic
No off target data available for this crispr