ID: 1193237948

View in Genome Browser
Species Human (GRCh38)
Location X:79131650-79131672
Sequence TTTTAGAGGCAGAGGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193237948_1193237955 15 Left 1193237948 X:79131650-79131672 CCTTGCACCCTCTGCCTCTAAAA No data
Right 1193237955 X:79131688-79131710 ATCTAACAAGGGATGCAGTCTGG No data
1193237948_1193237953 3 Left 1193237948 X:79131650-79131672 CCTTGCACCCTCTGCCTCTAAAA No data
Right 1193237953 X:79131676-79131698 ACAGACACTCAAATCTAACAAGG No data
1193237948_1193237954 4 Left 1193237948 X:79131650-79131672 CCTTGCACCCTCTGCCTCTAAAA No data
Right 1193237954 X:79131677-79131699 CAGACACTCAAATCTAACAAGGG No data
1193237948_1193237956 23 Left 1193237948 X:79131650-79131672 CCTTGCACCCTCTGCCTCTAAAA No data
Right 1193237956 X:79131696-79131718 AGGGATGCAGTCTGGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193237948 Original CRISPR TTTTAGAGGCAGAGGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr