ID: 1193245217

View in Genome Browser
Species Human (GRCh38)
Location X:79220569-79220591
Sequence GAGAAAAAAGCCCTCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193245217_1193245221 9 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245221 X:79220601-79220623 CTCAGCAGCTGTGGCAGAGGTGG No data
1193245217_1193245226 24 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245226 X:79220616-79220638 AGAGGTGGCAGGGGAATGAAGGG No data
1193245217_1193245218 0 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245218 X:79220592-79220614 TGATATTACCTCAGCAGCTGTGG No data
1193245217_1193245224 15 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245224 X:79220607-79220629 AGCTGTGGCAGAGGTGGCAGGGG No data
1193245217_1193245219 6 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245219 X:79220598-79220620 TACCTCAGCAGCTGTGGCAGAGG No data
1193245217_1193245222 13 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245222 X:79220605-79220627 GCAGCTGTGGCAGAGGTGGCAGG No data
1193245217_1193245223 14 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245223 X:79220606-79220628 CAGCTGTGGCAGAGGTGGCAGGG No data
1193245217_1193245225 23 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245225 X:79220615-79220637 CAGAGGTGGCAGGGGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193245217 Original CRISPR GAGAAAAAAGCCCTCTTGTC TGG (reversed) Intergenic
No off target data available for this crispr