ID: 1193245220

View in Genome Browser
Species Human (GRCh38)
Location X:79220600-79220622
Sequence CACCTCTGCCACAGCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193245220_1193245226 -7 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245226 X:79220616-79220638 AGAGGTGGCAGGGGAATGAAGGG No data
1193245220_1193245228 13 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245228 X:79220636-79220658 GGGCAGTGTAACAACAGTAAGGG No data
1193245220_1193245227 12 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245227 X:79220635-79220657 AGGGCAGTGTAACAACAGTAAGG No data
1193245220_1193245225 -8 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245225 X:79220615-79220637 CAGAGGTGGCAGGGGAATGAAGG No data
1193245220_1193245229 14 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245229 X:79220637-79220659 GGCAGTGTAACAACAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193245220 Original CRISPR CACCTCTGCCACAGCTGCTG AGG (reversed) Intergenic
No off target data available for this crispr