ID: 1193245226

View in Genome Browser
Species Human (GRCh38)
Location X:79220616-79220638
Sequence AGAGGTGGCAGGGGAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193245217_1193245226 24 Left 1193245217 X:79220569-79220591 CCAGACAAGAGGGCTTTTTTCTC No data
Right 1193245226 X:79220616-79220638 AGAGGTGGCAGGGGAATGAAGGG No data
1193245220_1193245226 -7 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245226 X:79220616-79220638 AGAGGTGGCAGGGGAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193245226 Original CRISPR AGAGGTGGCAGGGGAATGAA GGG Intergenic
No off target data available for this crispr