ID: 1193245227

View in Genome Browser
Species Human (GRCh38)
Location X:79220635-79220657
Sequence AGGGCAGTGTAACAACAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193245220_1193245227 12 Left 1193245220 X:79220600-79220622 CCTCAGCAGCTGTGGCAGAGGTG No data
Right 1193245227 X:79220635-79220657 AGGGCAGTGTAACAACAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193245227 Original CRISPR AGGGCAGTGTAACAACAGTA AGG Intergenic
No off target data available for this crispr