ID: 1193249487

View in Genome Browser
Species Human (GRCh38)
Location X:79271988-79272010
Sequence ACTTGGGACTTCAGGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193249487_1193249490 -10 Left 1193249487 X:79271988-79272010 CCATTATCCCTGAAGTCCCAAGT No data
Right 1193249490 X:79272001-79272023 AGTCCCAAGTTTCTTGCTGTTGG No data
1193249487_1193249495 21 Left 1193249487 X:79271988-79272010 CCATTATCCCTGAAGTCCCAAGT No data
Right 1193249495 X:79272032-79272054 GGAGCAAAATCTAGTTGACTGGG No data
1193249487_1193249494 20 Left 1193249487 X:79271988-79272010 CCATTATCCCTGAAGTCCCAAGT No data
Right 1193249494 X:79272031-79272053 AGGAGCAAAATCTAGTTGACTGG No data
1193249487_1193249493 0 Left 1193249487 X:79271988-79272010 CCATTATCCCTGAAGTCCCAAGT No data
Right 1193249493 X:79272011-79272033 TTCTTGCTGTTGGATCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193249487 Original CRISPR ACTTGGGACTTCAGGGATAA TGG (reversed) Intergenic
No off target data available for this crispr