ID: 1193250710

View in Genome Browser
Species Human (GRCh38)
Location X:79288363-79288385
Sequence GCTACCACACAGAACTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193250710_1193250713 1 Left 1193250710 X:79288363-79288385 CCCAGAGAGTTCTGTGTGGTAGC No data
Right 1193250713 X:79288387-79288409 TCTGTAGCAGAGCACAGTCAGGG No data
1193250710_1193250714 18 Left 1193250710 X:79288363-79288385 CCCAGAGAGTTCTGTGTGGTAGC No data
Right 1193250714 X:79288404-79288426 TCAGGGATGCCCATCCCCCTAGG No data
1193250710_1193250712 0 Left 1193250710 X:79288363-79288385 CCCAGAGAGTTCTGTGTGGTAGC No data
Right 1193250712 X:79288386-79288408 ATCTGTAGCAGAGCACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193250710 Original CRISPR GCTACCACACAGAACTCTCT GGG (reversed) Intergenic
No off target data available for this crispr