ID: 1193252889

View in Genome Browser
Species Human (GRCh38)
Location X:79313319-79313341
Sequence AGTCTGCTAGTACTTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193252889_1193252893 23 Left 1193252889 X:79313319-79313341 CCTCCACAAAGTACTAGCAGACT No data
Right 1193252893 X:79313365-79313387 ATCATCCATCATGATGAAGTGGG No data
1193252889_1193252892 22 Left 1193252889 X:79313319-79313341 CCTCCACAAAGTACTAGCAGACT No data
Right 1193252892 X:79313364-79313386 AATCATCCATCATGATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193252889 Original CRISPR AGTCTGCTAGTACTTTGTGG AGG (reversed) Intergenic
No off target data available for this crispr