ID: 1193260686

View in Genome Browser
Species Human (GRCh38)
Location X:79403512-79403534
Sequence GTGTTGTAGCCCGCAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193260686_1193260689 21 Left 1193260686 X:79403512-79403534 CCACTGTTTGCGGGCTACAACAC No data
Right 1193260689 X:79403556-79403578 GAAAGACATTCTAGTCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193260686 Original CRISPR GTGTTGTAGCCCGCAAACAG TGG (reversed) Intergenic
No off target data available for this crispr