ID: 1193265592

View in Genome Browser
Species Human (GRCh38)
Location X:79464484-79464506
Sequence GGGCTTCTCCCGTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193265583_1193265592 4 Left 1193265583 X:79464457-79464479 CCCCCCTTATCACTGTAGGCACA No data
Right 1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG No data
1193265586_1193265592 1 Left 1193265586 X:79464460-79464482 CCCTTATCACTGTAGGCACAGTT No data
Right 1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG No data
1193265587_1193265592 0 Left 1193265587 X:79464461-79464483 CCTTATCACTGTAGGCACAGTTG No data
Right 1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG No data
1193265585_1193265592 2 Left 1193265585 X:79464459-79464481 CCCCTTATCACTGTAGGCACAGT No data
Right 1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG No data
1193265584_1193265592 3 Left 1193265584 X:79464458-79464480 CCCCCTTATCACTGTAGGCACAG No data
Right 1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193265592 Original CRISPR GGGCTTCTCCCGTGGAAGCC TGG Intergenic
No off target data available for this crispr