ID: 1193266691

View in Genome Browser
Species Human (GRCh38)
Location X:79480438-79480460
Sequence CTCATTTTGATACCAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193266691_1193266693 28 Left 1193266691 X:79480438-79480460 CCAGAGACTGGTATCAAAATGAG No data
Right 1193266693 X:79480489-79480511 TTCCTCCTTTTCAATTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193266691 Original CRISPR CTCATTTTGATACCAGTCTC TGG (reversed) Intergenic
No off target data available for this crispr