ID: 1193270977

View in Genome Browser
Species Human (GRCh38)
Location X:79530318-79530340
Sequence GTCTGAAGTCCGCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193270977_1193270984 29 Left 1193270977 X:79530318-79530340 CCTGTCTCCAGCGGACTTCAGAC No data
Right 1193270984 X:79530370-79530392 AGAGTGGGTCTTAACCTCTGAGG No data
1193270977_1193270979 -2 Left 1193270977 X:79530318-79530340 CCTGTCTCCAGCGGACTTCAGAC No data
Right 1193270979 X:79530339-79530361 ACCTCTGCTATTGTCTGACTAGG No data
1193270977_1193270981 13 Left 1193270977 X:79530318-79530340 CCTGTCTCCAGCGGACTTCAGAC No data
Right 1193270981 X:79530354-79530376 TGACTAGGACTCCATTAGAGTGG No data
1193270977_1193270982 14 Left 1193270977 X:79530318-79530340 CCTGTCTCCAGCGGACTTCAGAC No data
Right 1193270982 X:79530355-79530377 GACTAGGACTCCATTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193270977 Original CRISPR GTCTGAAGTCCGCTGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr