ID: 1193271117

View in Genome Browser
Species Human (GRCh38)
Location X:79530916-79530938
Sequence GGGACCCCTCGCGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193271117_1193271133 29 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271133 X:79530968-79530990 GCACACTGCGCAGGACTGGCAGG No data
1193271117_1193271121 -8 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271121 X:79530931-79530953 GGGGTCCCATGGACCACCCAAGG No data
1193271117_1193271128 7 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271128 X:79530946-79530968 ACCCAAGGGCTGAGGAGTGTGGG 0: 124
1: 630
2: 599
3: 296
4: 311
1193271117_1193271131 20 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271131 X:79530959-79530981 GGAGTGTGGGCACACTGCGCAGG No data
1193271117_1193271122 -7 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271122 X:79530932-79530954 GGGTCCCATGGACCACCCAAGGG No data
1193271117_1193271125 -1 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271125 X:79530938-79530960 CATGGACCACCCAAGGGCTGAGG 0: 21
1: 796
2: 606
3: 424
4: 382
1193271117_1193271132 25 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271132 X:79530964-79530986 GTGGGCACACTGCGCAGGACTGG No data
1193271117_1193271127 6 Left 1193271117 X:79530916-79530938 CCCTGCTCCACGCGAGGGGTCCC No data
Right 1193271127 X:79530945-79530967 CACCCAAGGGCTGAGGAGTGTGG 0: 455
1: 339
2: 243
3: 121
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193271117 Original CRISPR GGGACCCCTCGCGTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr