ID: 1193272687

View in Genome Browser
Species Human (GRCh38)
Location X:79547253-79547275
Sequence TAAGGTAGAAAACCTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193272687_1193272690 9 Left 1193272687 X:79547253-79547275 CCCAGAACAGGTTTTCTACCTTA No data
Right 1193272690 X:79547285-79547307 GAGAAAGAAGAATTGCCACCTGG No data
1193272687_1193272691 17 Left 1193272687 X:79547253-79547275 CCCAGAACAGGTTTTCTACCTTA No data
Right 1193272691 X:79547293-79547315 AGAATTGCCACCTGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193272687 Original CRISPR TAAGGTAGAAAACCTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr