ID: 1193273263

View in Genome Browser
Species Human (GRCh38)
Location X:79554184-79554206
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193273260_1193273263 4 Left 1193273260 X:79554157-79554179 CCTAGAGACTTGCTAAATGGTTT No data
Right 1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193273263 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intergenic