ID: 1193284984

View in Genome Browser
Species Human (GRCh38)
Location X:79701747-79701769
Sequence GGTCTCCTGATTCTCTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193284981_1193284984 6 Left 1193284981 X:79701718-79701740 CCGGTAAATAGCTAGAGGAAGCA No data
Right 1193284984 X:79701747-79701769 GGTCTCCTGATTCTCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193284984 Original CRISPR GGTCTCCTGATTCTCTGTCT AGG Intergenic
No off target data available for this crispr