ID: 1193286574

View in Genome Browser
Species Human (GRCh38)
Location X:79721895-79721917
Sequence GTAGAGCCACTGTGGTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286574_1193286580 12 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286580 X:79721930-79721952 TTCTCTCAGCTCACCCTAATGGG No data
1193286574_1193286581 15 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286581 X:79721933-79721955 TCTCAGCTCACCCTAATGGGTGG No data
1193286574_1193286582 22 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286574_1193286579 11 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286579 X:79721929-79721951 GTTCTCTCAGCTCACCCTAATGG No data
1193286574_1193286584 25 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286574 Original CRISPR GTAGAGCCACTGTGGTCAAG AGG (reversed) Intergenic